Transcript

nfe2-201

ID
ZDB-TSCRIPT-090929-4550
Name
nfe2-201
Previous Names
  • nfe2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019715 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019715|OTTDARG00000016404|ZDB-GENE-030124-1 nfe2|OTTDARP00000016655 nfe2-001 LG_ BX571773.12 Danio rerio protein_coding KNOWN, 1640 bp
GACATTTGGAGCACATGGGAAGGGAAACACCAAACTGTTT
TAAAGGAGATATATTTTTACAGAATAAGCCACGGAGTGAT
ATCATCTTCGATTTATGGGTGTGTGGATGGAAAGTAGTTA
AGTTACACTAAAGATTGCTGGCCTGCTGACCACAGATGAA
CTATATTAGTGGTTATAGTGATTCAGTGCAGCAGGGGTTT
GTCCTGAATGTGTTCAGCAGTCAGCGGTGTACTTCCCCTG
AGGATCAGCTGTGAGGGACTGCCAAACCCTGGACGACTGC
ATGGGGAGGTATCAATGTCCACCAATGTCACTGGATTACG
GACACATCGTTCCCCCCAGAATTTGGAGATGGACTTGGCC
TGGCAGGAACTAATGGCCATCACAGAACTTCAGGAGTTTG
AGGAACCCAATGAGAATCCTTTCGAAGCAATTCCATACCT
CTCCATGGAGCCCATGGTATCTCAAGGGGGGTTCGGGATG
AATCAGCCACAGCCTGAATCCATTCCAGCCACTTGTGATG
CCCATCCTTCTGGTGTATATGAAAGCGCATACCCGGAAAT
GATGCCACCCTATCCACACATGGATATGCACTACGGTCTT
GCTGGTGGCCACGGTTCTTCCAGAATGCTTGCAAATACAC
AAGGTTTTCACCCACCTCTTATGAGCCTTTTGGAGCACAT
GAACATGACTACACGTGGTCATGGGATTGTGAAAGATGGT
ATTATTAATTTTCACTCTACAGGACAAATCAAACAAGTTT
GTACAGATGATCTGGAGTCAGATTCTGGTTTGTCGCTTGG
TTCGAGTCCGCCGCTCGCTTCTCCTGAGAACGCAGTACAT
GGAGTTCCTGCATATTTGCCTACTGATATTTCTACAGGCT
ATGCTGAAAGTGAAAGTATTGGGGAACAATGTCGCCTACG
ACCTAATCTGCATGGGGCTGTTGACTACCAGCAGTCATAC
AGCTCATATCCTGGAGCTTCTTTTCCAACATCTGCAAACA
TGCCATCTAGCAACCTGCACACTTACAGTCCGGTGGCATC
AATAAAGCAACCAGTTTTGCCCACAGCCTTGGATGATCTA
CAGCTAAATAGCTCAAGAGTAGGTTCATATCAGTCCCCAT
ACCCAAAGTGTAAATCCAGCAGTGTTCCTGTACCCCTCAG
CAGAGATGAACGGCGAGCCCTCGCTCTTAAAATCCCATTC
TCACTGGAAAAGATTGTGAACCTACCAGTGGATGACTTCA
ATGAGCTCTTGACCCAATTCACACTGAACGATGCTCAGCT
GGCACTTGTAAGGGATATTCGCAGAAGAGGAAAGAACAAA
GTTGCGGCTCAGAACTGTCGTAAACGGAAGTTGGAGAATA
TTGTGCATTTAGAAAGTGAGCTGGGACAGCTCCGAGCCCA
AAGAGAACATTTAGCCAGAGAGAGACTGGAGTTTCAGCAA
AACATAGCCATCATCAAATGTCGGCTCTCAGATCTTCACA
CCCAAGTGTTTTCCCAGCTGCATGATGAGGAGGGACATCC
ATATTCAGTTGATGAATATTCACTACAGCAAACGAATGAT
GGCAACATTTACTTCGTGCCACGGAATGCAGCACTGGCTG
GTGAATGAATGTTTGATTAAAGTGATAGTTCACCCAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations