ZFIN ID: ZDB-TSCRIPT-090929-4509
Transcript Name: mrps18b-201
Previous Name: mrps18b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019585 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019585|OTTDARG00000016315|ZDB-GENE-050417-278 mrps18b|OTTDARP00000016564 CH211-215A10.7-001 LG_ BX510301.6 Danio rerio protein_coding NOVEL, 1124 bp
AACTTCCGTGTTTCCTGCAAAGACAAAATGGCAGCCTCCT
TACAACGCATTGGGATAGTTGCTTGCCGCACATTTCCCGT
TAATTTACAACGACATCTTCAAGCACAGAGAATTCGTGAT
GTAAGAATAACGTCCATTGTCGCTCCGGTGCATCGTGTCA
ATTATTGTGCATCATCTTCATCTGCTGATAACACCAATTC
AGCGGAGACGCTATCTAGATATGCAGACACACCATGGGAG
TACTTAAAAAGTGAAGAATACATTGAACGCTATGGAACAA
AGCCTGTGTGGACAAACTACAGGAGGAATCATAAAGGTGG
GATCCCACCTCAAAAGACAAGAAAAACCTGTATTAGAGGA
GATAAGAAATGTGCGAACCCGTGTCCCATCTGTCGTGATC
CAAATATCATTATCCATTACAAGAATGTGAACTTGTTGCA
GCAGTTCTTTTGTCCTGAAACTGGAGTGGTACATGATCCC
ACAGTAACCGGTGTGTGCATGAAGCAACAGAAACTACTTA
GCAAGGCTATTGAAACTGCTAAAGATTTTGGTTTACTTCG
TGCCCAGTTTGCACATGTGGATTTCACTAAAGAAGACTAT
TCAAACACTCATGGTGCTGTAACCACAACTCCTCCTCCAT
TTCCCCTCAGCTCTGGAGAACTGTGGTATTCTTGGTATGG
TAGTATAAAACCAGACGAGCGAGAACTGGCAAGAGTGAAG
CGGATCTACAAAGACTACCTTAAACCTGAAGTCTGAATCT
TGCTTTAACAGACCTTAGTCAGATGAGATGGAGTCCTGAA
ATTTGTGTACACATTTACTGTGGTGATTGGTCACATCTCA
CTTTTAAAATAGTTGATGTTTAGTCAGCTGAACAGCAGCA
GTCCATTAAACACATTACTATAATTAGTCAAAAAATATTC
CAATTATCAATAAAATACAGCTTTATCCAGAGTAAATTCT
TTAAGCAAAGCAAATTTGGAATTTTCATCCGCCTTGTTTC
TCTGCCAGCACTTAAAACGACCACAAGAAAATAGACATTT
GCTTTTGACATGGTTACATTTGTTCCTACCAAGACAAGCA
TAATATATGAAGCATAAAATGAAATAAAACTCTGAAAATC
TTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mrps18b-201 Contained in:
[BAC] CH211-215A10 (1)

Genome Resources: Vega_Trans:OTTDART00000019585 (1),  Ensembl_Trans:ENSDART00000023074 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CF549582 (1) 629 bp
GenBank:AW280786 (1) 559 bp
GenBank:BI350584 (1) 546 bp
GenBank:BM343055 (1) 512 bp
CITATIONS (2)