Transcript

foxn4-002

ID
ZDB-TSCRIPT-090929-4323
Name
foxn4-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019173 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019173|OTTDARG00000015990|ZDB-GENE-990415-277 foxn4|no_translation foxn4-002 LG_none BX510917.5,BX510366.5 Danio rerio protein_coding KNOWN, 614 bp
AGACACACAAAATAACTGAAAAGTGAGGGTTGTCATAGCG
ACCCCAATTATTGCACTGAATAGAGAGTTTGTAGGGAAGT
CTGGAGAGAATTCAAGATGGTTTCTCTGCTCTCTTGATGC
TTAGAGCAAATGAAGAAATGGCTGAGTAAATAACTCTCCC
TGCGCTGGATTAGATCTGAGGAGACTCCTGACTACAGACC
CTTCGCAGCTGAAGGACGAACTGCCTGGTGATCTTCAATC
TCTGTCCTGGCTCACCTCTGTGGATGTTCCCCGACTGCAG
CAGATTGGGGGTGGACGGCCAGATTTCACTAGCTCTGCTC
AAAGCAGCCTACTGGAGCGACAGACAGCTCAGTTGAACAG
CATGACGGTAGCAGGAGGAGCAGGATCTGCGATTCATCTA
CAGAGTGAAATGCAGCACAGCCCTCTGGCCATCAACAGCA
TGCCCCAGTTTTCCCCTGGGTTTCCGTGTGCCGCATCAGT
GTACCAGACGGCTCCTCAGCAGGTGCTCACTTTCACCCAA
GCAAACCAACAGTGTTCACCCGGTGGACTGTATGGAAACT
ACAACAGCCAGAATTTGTTTCCTCAACCCCGGATTACTGC
TCACAGCCAGGACC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations