header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4081
Transcript Name: bag6l-202
Previous Names: bag6l-001, bat3l-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018442 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018442|OTTDARG00000015389|ZDB-GENE-060307-2 bag6l|OTTDARP00000015571 CH211-215A10.6-001 LG_ BX510301.6 Danio rerio protein_coding NOVEL, 3483 bp
ATGGAGGAATCAGGAGTCATAGAGGTGACCGTAAAAACTC
TGGACTCCCAGAGCAGGACGTTCACCGTCAGAGGAGAGTG
GACAGTGAAGCAGTTTAAGGAGCACATCGCTGCTTCTGTT
GAAATCTCTGTGGATAAGCAGAGGTTGATTTACCAGGGTA
AAGTGCTACAGGATGAAAGGACACTTACAGAATACAATGT
TGATGGGAAGGTCATTCATCTTGTGGAGCGGCCGCCTCCT
CAGAGCAGTCAGCCTGGAGGTGGAGGAGGTGGAGTTTCTG
GCTCCTCAGGTGCGGCAGATGGAGGATCTTCTTCCTCTCA
GTCATCAGCTTATACAACTTCACACGACCGTAATGCCAAC
AACTACGTCATGCTGGGGACTTTTAACCTGCCGGTGAACA
TCATGGACCCACAGCAAATACAGATGTCAGTGCAGCAGAT
GCTGGCTGGTGTTGGAGAAATGGGGCGTAATGTCAGAGTG
AGCACCAGCACAGGAAGCAGTGGCTCCGTGGACGTTCATA
TCAATGTGGACCAATCAGTGCAGAGCGAGCCCAGGATGAG
ACTCCATCTGGCTGAAAACTTGCTGCGGGAGACTCAGGCT
TTAATCCACAGGCTTGAGGGTCAATCAAGTGAACCGTCTC
AGCAGGAGACTCCACCTCCTCAGCCATCTTCATCATCATT
CTCAGCACATCCAATGGACAGCTCCCCACCTCCACCATCC
GTCTCATCCTCTGCTTCCCAGACCGAAGGAGAAACTCAGT
CTGGACCAAATCACCCAAGCCCTTTAGAGTTGGTAGAGGT
TCTATCAGAGGTACGAAGGGTGGAGGAGCGTCTCCGTCCT
TTCATGGAGAGAACACATTCAATCCTCGGAGCGGCCACTT
CTGCTGACTACAATAACAATACTCAAGAACGGGAGGAAGA
TCAGCGCACTCTCAACTTGATTGGAGAGTCCCTCCATCTC
CTTGGCAATACATTGGTGGCTCTGAGTGACCTTCGATGTA
ATTTATCTGCTCAGCCTCCCCGGCACTTACATGTGGTGCG
GCCGATGTCTCACTATACCTCCCCTGTAATGATGCAGAGT
GGACTGCCCCATATACCCATTCCAATGAACCTGGGCTCCA
CTGTGACCATGACGTCAAACAGCAGACAGACAAGCGATGG
TCAGCCCCAACCTCCACATTCCAGCAACCAATCAGATCAG
CAGGGTCAGGCTCCTCCTACTCCAGCAAATGAATCCAATC
AACAGACAGGACATGGACAGGGGACTCCAAGAGTGATCAG
GATCACTCATCAGACCATGGAGCCAGTGGTCATGATGCAG
ATGAACCTGGACGGCACCACAGTGCCCCTCCATGTACCAG
GTCTGCCACCGGAGTTCATGCAGGCCATCATGCATCAGAT
CTCCCAACAGGCTGTCACCATGGCAACTGCAGCCTCTGCC
GGACACCAGGGGCAACAGCAGGGCACTGCTGGCGCAGGTG
CTCAGAATGGAGAGAGCCCAGTCCCTCCACCACCTCAGGC
CAGGGTGGTCATAACAAGGCCCACCCTATCCCCTCGTGTC
CCCCAACCCATGGGCACCAGAGGAACCACCATCAACCTGC
GTGCGGCAGTGCCCCCCCCATCAGGGCAACAGACTAACCA
AATGGTCAGTGGCTTGGTTGGGCAGCTTTTGCTGCCATTG
CACACAGGGGACCAGACATCCACTACCTCATCGTCCCATT
CCTTTTCTTTCTCTACCTCCTCATCCACATCTTCTTCCTC
CTCTTTTTCTTCCGCCTCTCCTCCTCTATCCTCTGCCAAC
ACATCCGGTCAGACATCCACACACACCACCAGCACAGCGT
CTGTAGGTCAGGCCCAGGAGAGCGGCCCAGGAGACAATCT
AGCCCAGCTGCTGGGCTCACTTCTGGGAGGAGCTGCAGGA
GCTGGCGGAGGAGTGTCTGGAGCCACTCCCTCCATCACAG
TGACTGTTCCGGGTGTCCCTGCATTCATTCAGGGCTTGTC
TGAGTTCATTCAGTCGGGCCAGCCTGTGTTTCCTTCACCG
AATCAGCAGCCTCCACCCTCACAAGCCACGCCACCTTCTG
CCCCTTCAGGACCCGCCCCCACCACCGCCCCTAGTGGAGG
AGCGGAGACCCTCAGCCCTGAGCTTTTCACAGGCATAGTT
CAAGGTGTGCTGTCCACCATGATGGGCTCTCTGGGGGCTG
GTCAAGGCAACACTGAGAGCATCGCCCAGTTTATCCAGAG
ACTGTCCCAGACCAGCAACCTCTTCACCCCTGGGGCTGGA
GACGCAGTGGGGTTTTTCGGAGATCTGCTGTCTCTGGTGT
GTCAGAGTTTCTCAATGGTGGACATGGTTCTGCTTCTGCA
TGGTAATCCGCAACCTCTGAGCCGCATCCAGCCCCAGCTC
ACAGCCTTCTTCACGGAGCATTATCTGCAGGGTCGAGAGC
CCACTGATGCCAATATCGCTAGTGCTTCTGAGGATCTGAT
CAATGAACTAGAGGAGTACATTGCAGAGAGTTTTTCTACA
GTAACCGTTAGAGAAGGAGTGGACATCATTCAAACCAACA
TGTCCTTCCTGAGACAACAGTTCACTCGCATGGCTACTCA
TATTCTTCGCTGTACAGACAACACATTTGGCCAGCGTTTG
CTGTATCTGTGCACTCAGGGTCTTTTTGAGTGTCTGGCCC
TCAATCTCTACTGCTTAAGAGGAGAACAAAGAGCTTTGAC
CACTGTCATAAACCACCGAATTAGGAGGATGTCAGCAGAA
GTGAACCCCAGTCTGGTGAACTGGTTGACCAGTATGATGT
CCATGAGGCTGCATGTAATTTTAGAGCACAATCCGGTCAC
TGAGGACCAGATCCAGCATTACGTCATCTATACGCAGAGC
GAATCTGCTCGGAGAACAGAGGCAGGTTCACAGTCAAGCC
AGCAGTCACAAAATATGAATGTGGAGGAGGGCCTGTCTCC
TGCTCCTGCCACCACAGCAGAGGAAGCGCTGAGATCCACA
GGAGACACTGATGGAGATGAAGCACCCGGCAGACCATCGG
CAGAAGAGACACGAGGAGCCGTAGCCATGGCAACCACAGA
AAGGGAGGAGTCAACTGGAGAGGCAGAGCCATGGGCGGCA
ACCGTTCCACCTGAGTGGGTTCCCATCATCAGACGTGACA
TGTTGACCCAGAGGAAGATGAAAGCACAGCCTCCTCTGTC
TGATGCGTATATGCATGGGATGCCGGCTAAGAGGAGAAAG
ACGGCACAGGGGGAAGGACCTCACCTCTCTCTTACTGAAG
CCGTGAGTCGAGCTGCCCGGACAGCGGGAGTGCGACCGGT
TACTGCCCCAGACAGCCTACAGGGAGAGCTGGAGACCCCA
GAGCTGCAGGAAGCATATGCGCAACAGGTGAAGAGTGACA
TAAAGAAGCGTCTGAGTGACGATCCAGACTACAACCACCA
GCGCTTTCCCAACACACACAGAGTGTTTTCTGAAGACGCC
TGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bag6l-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000018442 (1),  Ensembl_Trans:ENSDART00000135128 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AL924713 (1) 454 bp
GenBank:AL925003 (1) 454 bp
CITATIONS (2)