Transcript

irx1b-201

ID
ZDB-TSCRIPT-090929-3941
Name
irx1b-201
Previous Names
  • irx1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000017876 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000017876|OTTDARG00000014940|ZDB-GENE-010716-1 irx1b|OTTDARP00000015106 irx1b-001 LG_ BX511306.10 Danio rerio protein_coding KNOWN, 1746 bp
ACGCATCACTAGACGTTCCTCCTGAAGAGACCGCGCTTCT
GCACCAAGCGAGAGTTATTGCTGTGATTGAAAGTGGATTG
CCCTTCTCTCTTGTAAATCTCCGACAGAGTTCCTCGGGAG
TTGGACATGTCGTTCCCCCAACTGGGTTACCCACAGTTCC
TAAACGCCTCCCAAGAGGTGTACGGAGCGGAGCGCACGGG
TGTAATGCCGTCCTCTCCACGCGAGGGAAGCTCGGACAAC
AGCGCAAATCCCGCGACTGCAGCGGCTGCTATCACGCCGA
TGCTCGGCATGTATGCGAATCCGTGGACCGTGCAAAATTA
TAGCGCCTTCTTACCTTACAACAGTGCCGAGCTGGCCCTG
CTCTCTCAGATGGGGTCGCAGTATGAGCTGAAGGATAACC
CCGGGGCTCATCCTCCAGGATTTGCAGTGCACGCTGCGCC
CGGTTTTTATCCATACGGCCAGTATCAGTACGGTGATCCG
GCCCGGGCCAAGAGCGCTACCAGAGAAACCACCAGCACAC
TGAAAGCATGGTTGCAGGAACACAAAAAGAACCCGTATCC
CACCAAAGGTGAGAAGATCATGCTGGCCATCATCACGAAG
ATGACCCTTACGCAGGTGTCCACCTGGTTCGCCAACGCGC
GCCGGAGACTCAAAAAGGAGAATAAAGTGACCTGGGGTCG
CAGTGCCGAGGACAGAGACGGGCGAATTTTCGACAGCGAC
AACGAGGATGATGCGGACAAAAATGACGACGAGGAAGAAA
TCGATCTGGAGACCATCGATATGGACAAGGCGGAGGAGCC
CAGAGTGGACCAGAACAAGGAAGCAGCGAATAACCCGCAC
GCGATTGAAAACATTGAAACACCGCGGATATTATCTTCCC
CAGCACTTAAAAACACGGACAGTCCTATGTCGAGTGGTAA
TAGAGAACAGAATGTGGTCAAAAGCGTTGGTGAGGTGTCT
CCTGGTGGAGCAGTGTGTCAAAGGCCTGGAAACAGCAAAC
CCAAAATCTGGTCTTTGGCGGAGACGGCAACAAGTCCTGA
TAATACGCAAAAACTCAGTATCCCGTCGACGCCTGCAGGC
CTCAGGGCCTCACCTTCAACCCATCCTGCTTTTCTCTCCA
CAAACGGAATTTATACTTGCCAGATTGGGAAACTACACAA
TTGGGCGAGCGCCGCTTTCCTCAGTGCTAATTCTCTGATG
GGTGTGCGCTCACTTTTGAGTCAAAACAGTAACTTTCCAA
ACCACAGTCCCGTTACAAACCCCGAAAAGAAACCTTCGTC
TGCCTCTGGATCTCCATGTCTTGACAGCGACAACTCATCC
GACAGTTTCAGTCCCAAACATAATGATCAAGAGAACGTTC
AGAGAATTGAATCTCCAACACTTGCATCAAGATCACCGTT
TCCAGTCATCCATGACAGGTCTCATCATGAAACATCACAA
CGCGCTTTGAAGACAATTTCTTGAACACAGAACTTATCAG
AAACCTCTAAATTATTTAAAGAAAGTGAAATGTGACAATA
CAGCAACAGCATATACGTCATCGGATAGACCAAAATATTT
TTTGTATTTCTTATTACGCTCCCATCCAGCAATATAATTT
TTTTTTGTATTTTCTTTTCTATTCATTTCAGCATGTTTGA
GTTTACCGTGTAGGTCGCCTGCATTTCTTTTAAAGAGTTA
ATAAGAGTTATTTGTCAGAAATTGTGAAAATGATATATTT
TTGTGTAATAAAGAAAATGAGATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations