Transcript

clcn1a-201

ID
ZDB-TSCRIPT-090929-3889
Name
clcn1a-201
Previous Names
  • clcn1a-001
  • si:dkey-14o18.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000017743 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000017743|OTTDARG00000014838|ZDB-GENE-060503-333 clcn1a|OTTDARP00000015002 clcn1a-001 LG_ BX927218.17 Danio rerio protein_coding KNOWN, 3951 bp
TGTGCATGTGTGAAGAAGAGACAGAGAGATTGAGTGTGTG
TGTGTGCATGTGCCCGTGCCACCCCAGGGTGGGAATGCTA
AGACAGACGGGCAGTTTATTTTTGGGTCAGTGACAGTGTG
TCAATGGCCGCAGATGAGTCGCAAAGGAAGGCTCTGAGAT
ACCAGCAGACCGTGCTATATGGAGAGTACAGAGAGCACCC
TGGTGGGTCTCAGCGGAGAGAGGCTACTCGCCTTCTGATG
GAGAGACAGCGGAAAAAACATGGACATCACCACCACCACG
GACACTACCATCATGCTCACCAGGGGCGCAGTCACAGCCG
AAGCCGAAGTCGCCATCATAGCCGGCCCCATCTGGATCTG
GAGATAGGGAGCATTCATGATAGACCAGAGGAGGAGCAGG
GCCACACGTCGTCCTTCAAGAAACGCCGCTCTTACTCCAA
ATGCAGAGACTGTGTGGCTCGAGTACAGAAGTTCCTTGTC
TCGAAATTGGGAGAAGACTGGATCTTTCTGGTGTTGTTGG
GTATTACCATGGCGTTAGTTAGCTGGAGCATGGATTATGC
TAGTGCCAAGAGTCTGCAAGCCTATAAGTGGTTTTATGGT
GAGTTGAGGGGAAACATCCCACTGCAGTACCTGGTCTGGG
TCTCCTATCCCATGGTGCTCATCCTTTTTGCCTCCCTTTT
CTGCCACCTGGTCGCTCCTCAGGCAATTGGCTCTGGTATT
CCGGAGATGAAAACCATACTCAGAGGTGTTGTGCTGAAGG
AGTATTTGACACTCAAAGCATTTGTTGCGAAGGTGGTGGG
ACTCACTGCTGGCCTGGGCAGTGGTATGCCGGTTGGCAAA
GAGGGTCCATTTGTTCACATAGCCAGCATCTGTGCTGCTG
TGCTCAGCAAGTTTATGTCGTTCTTCTCTGGAGTCTATCA
GAGCCCATATGGTTATACAGACATCCTCACTGTGGGCTGT
GCAGTGGGGGTCGGATGCTGCTTTGGAACCCCTTTAGGAG
GTGTTTTGTTCAGCATCGAAGTTACATCAACCTACTTTGC
TGTGAGAAACTACTGGAGAGGCTACTTTGCTGCCACGTTC
AGCGCTTTTATTTTCAGAGTGCTGTCAGTGTTCAATAAGG
ATGCGGTCACCATCACTGCTCTCTTCCGCACCAACTTCCG
CATGGACTTTCCTTTCGACCTGCAGGAGCTCCCGGCGTTC
GCCATTATTGGGATTTCTTGTGGATTTCTGGGCGCTTTCT
TTGTTTACCTGAATCGTCAAGTTGTCCTGTTCATGAGAAG
ACCGAATATTCTCACACGATTCCTTACAAAACACCGGCTG
GTTTTCCCTGCTGTTGTGACCTTGGTGGTTACAACACTGA
CATTCCCGCCAGGCTTCGGGCAGTTCATGGCTGGAGAGCT
GATGCCCAGGGAGTGCATCAACTCTCTGTTTGATAACTTC
ACCTGGACTAAAATATGGGGATCCCCCCTCCCGCCGGGAC
TCGGACGCTCTGCTGTGTGGTTTCATCCTGACGTCAGCAT
CTTTGTCATTCTTATCCTCTTTTTGATCATGAAGTTCTGG
ATGTCTGCAGTTTCCACCACAATGCCCATCCCGTCTGGAG
CTTTCATGCCTGTCTTTGTTTTGGGTGCTGCGTTCGGTCG
TTTAGTGGGTGAGATCATGGCCACTCTCTTTCCCCACGGG
ATCCTGTTTGATGGGATCCTGTACCGCATCATCCCTGGAG
GGTACGCTGTCATTGGTGCGGCGGCGCTGACAGGAGCAGT
CACTCACACCGTCTCTACAGCGGTGATCTGTTTCGAGCTT
ACCGGTCAGATCTCTCACATCCTCCCCATGATGGTCGCTG
TCATCCTGGCCAACATGGTGGCTCAGGGTCTGCAGCCGTC
ACTCTACGACTCCATCATCCAGTTTAAAAAGCTGCCGTAT
CTCCCCGAGCTGGGCTTCGGCCATATAAGTCAGTATAATA
TCTTTGTGGAGGACATCATGGTGAGGAAAGTGAAGTTTTT
ATGTTCGCAGTCTACATACAGAGAAGTGCTGCATTTGCTG
GACTCGACCTCTTTAAAAACCTTCCCACTGGTCGACTCGA
AAGATTCTATGATTCTGTTGGGGAGCATTGAGAGATCTGA
GCTGCTCGCCCTCTGTGATTGGTGGCTGTCAGCAGAGAGG
CGGATCCTAATACAAGGACAGAGCCCACAAGGTCAAGTGC
CTTGTGCTAAAATCAGCTGGGAATCCTTTGCCTTTGTTGA
TGAAGATGAAGAAGATGAAGAAGAGAATGTAGATGAAAAG
ACAATACCAGTTCAAGAAGAGAGAAACGGCCCGGTGCCCC
CGCCCAAACCTTCAGAACCGTCCACCAATCACACGTCTCC
TGATAAGGGTCCTTCGCAGTCTTTCAGGAGACTTTTACGT
AACTTATTTTCGTCCTCGTCGGAAAGACACACAGAAGGTC
AGCCCCAGGAGCCTTATCCTCCACCTTTAACCGACACAAT
GACTCCAGAACAGATCAAAGCCTGGGAGGAGAGTGAAATG
GACAAACCTCTGGAAATAAACCAGATCAGAATAGATCCAT
CACCCTTTCAGCTGGTGGAGAGAACCTCACTACATAAGAC
ACACACACTTTTTTCTTTACTGGGCCTCAGTCATGCCTAT
GTAACCAATACTGGAAAATTAGTGGGAGTCGTGGCGCTGA
AAGAGCTTCAAAAAGCCATCGAGGGCTCGACACGCAGTGG
TGTCCGTCTGCGCCCCCCTCTGGCCAGCTTCAGGGACACC
CTCCGTAAAAAAGCCTCAAAGCCTCAGGCCTCATCTCCTC
CATCCTCACCCGTCTCCACCACCGCCCCGTCCTCACCTCT
GTCTCCACCTGTGATCTCCCACTCTCATTCCCACTCGCAC
TCCTCCAGCCCACCCGCCCCGGTGGAAGAGAATAAGAAGG
AGATGGAGGTGTGGATCGAGGGTGTGAAGCGGGATGTGAT
TGTGGGTAAAAGCAGCAGCACAACCACAGGAAGCAGCAGT
AGCAGTAGTCGTGGGAATGGAAGTAGTGACAGTGAGGCAG
GAAGTGGCGACAGCAGCCCGAATCTGCCGCCCTCCTCGCC
TCCACCCCCTATCCCACTCTCCAACCTGCAAGCTGTCCCG
GAGAACAAGGAGGAAGAAGAAAGCGAGGAGCCCGTTTAAG
ACAAGTGACGTTTGTTTTTCTTTTCTTTGAGGTGAGATTT
TTATATAACTCTTTTTTGTTTTGTTTTTTTGTTTTTTTTA
CTTTTGTCGTTTCAGAGTTTTAGGATGTCCCCTTGATCTC
CTTTTAGTTTTTCCTGCTTTTTTCTGTTAAAACATTTCTG
TGAGTAGTTTTTAGTTCTTTTTTTCCTCTTCGTGAAAACA
GGCTGACAATTTTAGAGAAAGAAGAAAAGTTTGAGTTGTT
TTTTTTTCATTCTATAAAAAAATGTAAAGAAGAAAGTGCT
CTCTTACTAATCTTCTTCCTCTAAGAAATTCTGTGAATGT
TCCCTTCTTTATTTCCTGTTTATTTCTTTCTATTTTATTT
TATTTTGTTGTAAATAAATCTTCAAATTCTACCGGGTTTT
TCTCTTCCTACCCTTTTTCTTTTGTAAAAAAAAAAACATC
ATTAATAATAAAAAAAAAGTCATATATATCATAAAACATG
CTATGAGATTGTCAAATATTTGTCTTCTCCTCAGTAACCT
TTAAAATATACTTTGGTTTCACTTCAAATGAAAATGAATA
TAAATGATCATAACTTTAAATGTTAGGAAGAGATGATGAA
GGAAGATTATGAAGGAAGTATTTTATTTTATGAGCTAAAG
AAGAAATTGAAGGAACATTTCACGGCTATAGTTGTTCAAA
CAAATAGTGTCCAGCAGGTGGCATATTTTCAGAACATTTC
AATGAAACATTTTCTCTTTTGCCCTTATCCACTCACTGGC
TACTTTATTAGGTACACCTTACTAGTATGGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations