Transcript

wt1b-201

ID
ZDB-TSCRIPT-090929-3334
Name
wt1b-201
Previous Names
  • wt1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000016155 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000016155|OTTDARG00000013586|ZDB-GENE-050420-319 wt1b|OTTDARP00000018079 CH211-160J6.3-001 LG_none BX248120.7,CR936403.5 Danio rerio protein_coding NOVEL, 1389 bp
AAACTCTCCCATGCATTTCTCCAAACACCTCACCAGCAGA
GAAACACACACACATTCTGCTTCAGCAGACGCCTTCAGGA
GCGCAGCGCTTATCTTTGACATTTTGAACTCAGATATTCT
AGTGTTTTGCAACCCAGAAAATCCGTCTAAATGCTGACAG
AGCCGTGCGGCCCGATGGGATCGGATGTCAGAGACCTGAG
CGCCCTGCTTCCAGCTGTCCCGACACTTCCAGTGGGAAAC
TCAAACTCTCTGCCTGTCGGCGGAGCTTCGCAGTGGGGCC
CGATGCTGGACTTTCACCCTGCCTCTCCCTATGGATCTCT
TCCTTCCCACTCCTTCGTGAAGCAGGAGCCTGGCTGGGGG
CCCCCAGACCCTTACGAGGACCCTCACTGCGGTTTGGGGG
CCTTCACTGTACACTTCTCTGGGCAGCTGACAGGGATGCA
CGGCCCATTTGCTGATCCTCCTTCTAGCCAAAGCAGAATG
TTCTCCAATGGGCCTTATTTGCCAGGCTGCATGGAGAGTC
CTCCTGCTCCACGCAACCAGGGTTATGGGACAGTAGCAGT
CGACGGAATTCCCAGTTACGGTCACACACCTACACAACAC
TCTCCTCCGTTCCCTAATGACACCTTCAAACACGAGGACC
CGATGTCTCCGCAAAGCACCATGGGTGAGCAGCAGTTCTC
CGTCCCGCCGCCTGTATACGGCTGTCACAGTCCACCAGAT
CAGACGCTGCTTCTAAGAAACTCCTTAAACAGTGATAATC
TGTACCAAATGAAGTCTCAGCTGGAGTGTGTGGCCTGGAA
TCCTGTTAGCTCACTGACGCCCAGCATCAAGAGCTCCAGT
TATGAAACTGAAGCATCTTCAGGAGCACCTCCTCTGGTCT
ACAGCTGCAGCACACAGTATCACATACACACACATGGGTT
GTTCAGAGGATTACAGGATGTGCGGCGAGTACCAGGCATC
CCTTCCTCCGGTAAATCATCATCAGACAGCAGTGAGAAAC
GGCCGTTCGTCTGCTCTTATCCAGGCTGCAGTAAGAGATA
CTTCAAACTGTCCCATCTGCAGATGCACGGCAGGAAACAC
ACAGGGGAAAAGCCGTATCAGTGCGATTACACGGGCTGCG
GCCGCCGCTTCTCCAGGTCTGACCAGCTGAAGAGACACCA
GCGCAGACACACAGGCGTCAAACCCTTTCAGTGTGAGACG
TGTCAGAGAAAGTTTTCACGCTCGGACCACCTGAAGACAC
ACACGCGGACTCATACAGGTAAAACAAGTGAGAAGCCGTT
TACGTGCCGCTGGCCGAGCTGTCAGAAGAAGTTTGCTCGC
TCAGATGAGCTGGTCAGACATCACAGCATGCATCAGAGAA
ACATGAGCAAACTGCAGCCCACCGTCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations