Transcript

msx3-201

ID
ZDB-TSCRIPT-090929-32
Name
msx3-201
Previous Names
  • msx3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002020 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002020|OTTDARG00000001892|ZDB-GENE-980526-306 msx3|OTTDARP00000001778 msxc-001 LG_ AL831745.3 Danio rerio protein_coding KNOWN, 2028 bp
GCGAGTGCGCTCTGCTTGGAGAGCGAGGCAAGCGTCGCAA
AAGCGCGACGGCAGAAGGGAAGCGCTGCTGGACCAGAGTA
CAGTTCAGGACGACTCACATATTCTTGTTGTATGGCCCCT
TTATCATCTATGATGAATTCTGAAGGGCCACTCTCCCAAG
AAGGAAAACTACAGGAGCGCAAAAGCGCGGACAAAGAGGA
TGCTCAATCCAACGATAAAGCGGCTGTCAAAGGATGTAAA
GGCAAAGCGCTGAGTCTCCCGTTCAGTGTGGAATCTTTAA
TATCAGACAGAACAAGCTCACGGACTTTATACACGTCTTC
TGAAGCTGGTATTATATCTCCGACATCCGGTGCGGATGAG
CGGCTGAAGCTCTCGCCCATGGCTCTTTACGCAGATAGGA
AGATCCCAGTGGAGAGCGTCTCCAACCTCTCCGACTGCAA
GAGAGGGGATATGGAAGAACTAAGTGACAAGGGACAGTCC
GGCTGGTTTCAGACAACCTCGTACACTTCTCCGCCAAGGC
ATTCAAGTCCACCCCCCTGTACCCTCAGAAAGCACAAGAA
CAACCGAAAACCGCGGACCCCGTTTACCACCTCGCAGTTG
CTCGCTTTGGAGAGAAAATTTCGTCAAAAACAGTATCTTT
CTATTGCAGAGAGAGCGGAATTTTCCAATTCACTCAACCT
CACAGAGACTCAAGTTAAAATCTGGTTTCAAAACAGACGG
GCGAAGGCAAAAAGACTCCAGGAGGCCGAACTAGAGAAAC
TGAAACTTGCAACCAAGCCGTTATTACCTGCGTTCGCCTT
TCCGTTCCCACTCGGAACACATGTTGGTTCTCCACCACTC
TACGGACCGTCCAGCTCCTTTCCCAGACCTGCCTTACCAG
TCCCGGGACTTTTCGGTGGGCCAGTGACCTACGGAATGTA
TTATTTGTCTTAACAGACTGAAGCACGTCCTTCAATTCAC
CGTCTGTAACTGCTGCAATTCTGCCAGTCAAAAGACGTGT
GAAATTGCAAATATGTTTCCTTTATAGAACTTAAGCAAAT
GCAAAAATTTAAAATAAATTATTTTTGTAATCCACACGGT
TTATTCCAAAAGTAATAGTACCCAAATTGGTTTTAAAAGT
GCAATGAATATTCCCCTTAATACAGAAGACTTTATGCTGT
ATTATACAAGTATAGCCTACAGACACACCGCTATGTGAAT
AATTGTCTTAGTCTCAGAGAAAATATTTCCAGTAGATTAT
TTCAAGGGCACAGCCGATCTAGAAAGTTTCTAGAGCAGCA
TCATTTGTTGATGTGTGATGCGAAAATAAACTCCTGGTTT
GTGCCAGTTCCAAAAAGCTCTTAAAGAAGACCTTATAATT
ACTATTTTTTTTTAAATTAAAGTGCTTGTTTCGACTGGCA
GCAGAATAGGCCTATACCGTAAAAATAAAAGTTTTACTGT
GTCATTGCTACTTTCCATAGGTCTGCCCTAATTGGGGCCT
AAATGGATTGTAAGAGCCTTTTTTAAATTAATCCATGTAT
TTTCACTCAAACCAAATATTTTGTAGAATATTACAAAGAT
TGTGCTCAGATATCAAAATTAGCAAATTCTCTACTGCCAA
TCTGGTTACTTGTTTTTATTTCTGCCCGCTATTAGTTTCA
GATATTCGATTTGTTATTTGGTTGGTCTTTATTGAATATG
ATCAACGAGAAACAGCATCTTCAATTACTCTATACTTTTT
CTTCCCAAACCTTTTGGGACACAGAGTATTTTGGCCTGTG
TTTTTTGATTTTCGCCTGTTTAGCCATAATCCCTTCAGTA
GACTACATGTATGCTAGTTTGCTAGGTTGTAAGAATAATG
TCTAGATTTTTTTATTATTGTAAATACACGTATATATTAC
AGATTTTGCATTCCCTTTGAACAAAAATACAAACAGAATT
GCTGATATTTATACACTGTTTACATTTATCTTCTGTAAAT
TATTGTATATTTTATATGTATATACAAATTAGAAATAATC
TTTTGCATTAAAATAAATCTTCACAGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations