Transcript

cdkn1ca-201

ID
ZDB-TSCRIPT-090929-3128
Name
cdkn1ca-201
Previous Names
  • cdkn1c-001
  • cdkn1ca-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000015502 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000015502|OTTDARG00000013085|ZDB-GENE-040123-1 cdkn1ca|OTTDARP00000013168 cdkn1c-001 LG_ AL928843.9 Danio rerio protein_coding KNOWN, 1566 bp
TTTGTTTCCTCGGAGGGCAGTAGAAGGTAGAAAGTTGGTC
TTATGGTGGTGTAGGCCTACTGAACCTTCTTGAGGAACAT
ACCCTCTGGATATCTCGCAGCTCGGCCATCTTGCGGATGT
GCTTGACGTCATTTCTCAAGTCACCTGGTTGGTTGAGTTT
CGCGCGCCATTGGTGGACACCGCCCTGCTGCGTCAGAATC
GCGCGGATTTGATAAAACGCCTGGAGTTTGATTTCGCGTT
TAAAAGACTGTGGTTTTCTTAAAAGAGGGGGGAAGGTGAC
TTTGTTGATACTGGTGGGGGGTTTATTACACAGGGCGTGG
TGTCTGTCTAGCCAATCGGAGGCCTTTTCTCGTGCAAACG
CTGGCCTTTAACCACCGGCACGGATATAAACAGATTACAA
ACAACAAGAACCAAACAAACGTCGGCTCACGGCATTGACT
TTTAGACATCATGGCAAACGTGGACGTATCAAGCAATCTG
GAGCGTCATGTTGCACGGAGCACTTTTCCTCTCCTCACCC
GCACAAAGGTCTGCCGTAACCTATTCGGACCCGTAGACCA
TGAGGAGCTGCACTGTGAGATGAAACGCAAACTGCAGGAG
ATCTCCGAGCGAGACCAGAGCCGGTGGAATTTTAACTTTG
AGACCAACTCGCCTTTGCCTGGAGATTACGAGTGGGAGGC
GATTTCAGAGGACACTTTGCCATTTTTCTACAAGGATAAA
GTACAAAACAAGAGAGCTCGTGCCGCGACGTCTGTTAACG
CAACAGGAGACGCTTCCAGCACTGTCGACTGCGGGATTTC
CAGGAGTCCGGTAGCTCAAGAATCCGAGGGAGTCCCAAGT
CGACCCAACGAACCCAACCAGGAGAACATCTCTGGCGCAC
TAAACTCCAAACCAGCTCGTTCTTCAGTCCTCAGAAACAG
ACGGAAGAGGTCACTTATCCCAGAGAGCCCCAGAAACAGC
ACGCCGCAAATTACAGACTTCTTCCCAAAAAGAAAGAGGG
TCGTGGAGTCGAAGCAGGATGAACGCAGTTACCTTCAAGC
CGGCACATCCACGAGCATTGAAGTAACGCCACGTAAAACT
ATTAGATGATGTTTGCACTATACATACATCAGTCCACCTG
TGTTTATCTGCAGAGCGGATGAAAGAAAGAAGTGGACGAG
ACCCTTTCTCTCTGAACTCATGTAGCAATAATGGCTCTGC
CAACAGAGACTTTGTTGCAGTGTTACAATGTCTAAACGGT
GCAATTTTCACTTTTCTTCTGTTATAATTGTGTAGAAGGC
TAGACCACAGTGCTCTAAACAGTCTAGAGCAAGACGTGTT
TGTTTTATTTTTGAATATACTAACTTATTTTATTTATGTT
CATAATAGTTGGTTACTCTTTATTATTTACAGCAATTGTT
ATTATTATTTTTATTGTTTCGGCCATATTTTATGTTGTGT
TTTATTTAAGTTTGGTTTGCAATTTCATGCAACGAATGTT
ATTGAGCCTTGTTTGTTAAAAAATATATTCTGTAGCTCAC
GTTGTACCTTTGAATCAAAGTGTAAATTAAATTATATTTT
TGCTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations