Transcript

ighv1-2-201

ID
ZDB-TSCRIPT-090929-311
Name
ighv1-2-201
Previous Names
  • ighv1-2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000004683 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000004683|OTTDARG00000004433|ZDB-GENE-030924-2 ighv1-2|OTTDARP00000004254 ighv1-2-001 LG_ BX649502.4 Danio rerio protein_coding KNOWN, 384 bp
AGTTATCTTTTTCTCTCTTCATTTCTTTTGAGGTTATGAT
GGACGTGTTACAATTTGGAGTTCTGCTGATGATTGTTTCA
ACTGTTCGTGGTCAGTCTTTGACCTCCTCAGACTCTGTGG
TGAAAAGACCAGGAGAATCAGTCACTCTGTCCTGCACTGT
GTCTGGATTCTCAATGAGCAGCTACTGGATGCACTGGATC
CGCCAGAAACCAGGGAAAGGACTGGAGTGGATCGGGCGAA
TTGATCGTGGCACTGGCACTATTTTTGCTCAGTCTTTACA
AGGCCAGTTCACCATCACCAAAGACACCAGTAAAAACATG
CTGTATTTAGAGGTGAAACAGCTGAAGAGTGAAGACACAG
CTGTTTATTACTGTGCACGAGACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations