Transcript

slc12a3-002

ID
ZDB-TSCRIPT-090929-3092
Name
slc12a3-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000015396 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000015396|OTTDARG00000012991|ZDB-GENE-030131-9505 slc12a3|no_translation slc12a3-002 LG_ BX470170.5 Danio rerio protein_coding KNOWN, 560 bp
ATGAACCTCCAAAGCGCAAGAAGCCCATTTTCAGTCTCCT
CGCTGAGCAATGGAGACGACCGTAAGTTCAGTTTGGGTGG
ATGTAGCAGTTATGACACTGACAGCGTGGCCTCACGCAGC
TCTGGTGTCTTTTCTGGATATGACACGCTGGATGCACCAC
CGAGTTACGACTTCTACACCAACACTGAGGTTTTCGGGAG
AGCCAAGAAATCCAGACCATCTCTCTTTGAGCTGCACTCC
AACCCTCAGGTACAGTAGGAATGACTTACCTGTACAATAT
TATCATTCCAATATTGTAAGGAAAGTCAGTGATGATTCCA
CAAAGGAAGGGACTTTTATTATTATTGTTTTTATTTGTGT
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTCAGGATGACC
CCTCTCCACCTCCCCTGTATGAGGAGTCCAGTGTGGACAA
ACAGAGTCCAGAGGATGAAGATGAGCCCACTGAACCACCT
CCAGAACCCGCTCGCTTTGGATGGGCTCAAGGAGTTATGA
TCCGCTGTATGCTGAATATCTGGGGTGTCATTCTGTACCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations