Transcript

fan1-201

ID
ZDB-TSCRIPT-090929-3078
Name
fan1-201
Previous Names
  • fan1-001
  • si:ch211-201b11.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000015356 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000015356|OTTDARG00000012965|ZDB-GENE-030131-6225 fan1|OTTDARP00000013034 CH211-201B11.2-001 LG_ BX548157.5 Danio rerio protein_coding NOVEL, 3591 bp
GGCTGGCTTCACATTTCCTCTCAGAGCCAGACAGAGTTAT
AAACAAACATGCAGCCTGCTTCATTTATATGACTCCATGT
CTTGTTGGTTCATATGACATGAGCACGCTTCTATTATGGA
GTCTCAGACCGGGAGAAAAAGTGCCAGAAGACTCTCAATG
ACCAAGAAAAAGAGCCAAAGTGTCTGTCCTATTAAAGAAA
GAACAAGTAATGGAGGAGCTGCTTCCATAACCTCATTTTT
CAGGAATACACCACCAAGTAAACTTGCCTGTCCTCTGTGT
GGCAAACTTGTACCTCGTTACAAGATTAATGAACACATAG
ACTCCCAGTGTCAGAACTTTCTTGTGGAGGATGACGGAAA
GCAAAAGGAAATCACCAAAGCACCTTCTAACAGTGCTTTA
GCATCAAATAATGAGAGAGAGAAAAGTCCTGGAGACAAAG
ATGCTGATACTAGTCCGTTTTTCAAAAAGAACTGTGCAGT
GAGGAGAGATTCATCTGAAACAGATTCACAAGCTAAACCG
GTTAAGACTGTTGGTCTGGGAAGTTTATCCTCTAAACTCT
CTAGACGAGCACTTAGACTTTCAGATGAGTCCGGAGTAAA
TCTTACTCGCGTCTCAGATAATGAAAAGGATCATAATGCA
GACTTGAACAGATCACAGAAGGAAAACTGCATGAATAGTT
TAACTTTTGGGTCTGAAAGAAATGGCACGGATGCAGATAA
TATATTAGAAACAGAGCCAGAAGCTTCAAATCAACCACAG
CTTAAAAATGTTGAGAAATCTGCATCAGATTCAAGCATAA
GCAGTGATGTTCACACATCCTCATCCAGTGTACTGAAGCG
AAAGTCCATGGAGATACCTAAAAATGACACAAACACTACA
GAAACATGTATTGCACATAAGAAAAGTAGATTTTTTCAAA
GCAGTATTGAAAGAGGAGATGAATCTAAGGTCAAATCAGA
TCAAACTGAAGCTTCGTCTAGTGCATATGATGTTCCAACA
TCAAAGAGTCCAATCAAAAGCAAAACCACACAGGAGGAGA
TTGAGAAGGAGCTGAATAAGACACCGGCTAATGAACACAA
CATGCTTGATGTTGAGAAAGTGGGTGAGGGATCAGAGCAG
CAGCCCACCAGGTTGCCTTATTATCTGCGAAACTTTCGGA
CTGTCCTTGAGGCTGTGTTGGAGAATGAGGATGATAGGAG
GCTCTTCAATGAAGACGACTTCTCAACAATTCAGTCTTTT
CAGCAGCTTTCAGTACCTGGTCAGATGCTTTATGTCCGTC
TGTTTCAAAGGAAGCTGAAGTGGCTTCAGGTCTGTAAGGT
GGAATACACAGAGATCAGCACAGATCTCAGACCTGTCGTT
CAAGAGCTTGTCGCATGTGGCTTCCTACAGACAGAATCTG
AGCTTCATGATCTCCACGAAGTTTTGGATCTGCTTCCGGC
ACCAGAGCTTAGAAACCTGGCCAAAACATTTCACCTTGGC
CGTGGAGGGAGTCAGAAACAGCAGTTGGTGGAGGGTTTGC
TCCAGCTGGGGAAACAGCGATCTCTCTTTGCTGGTCAAAA
CAACACAGCTGCAGTCATTCTCAAGAGGGCTAAGCAGGCT
GCAGGCTCCTGTGTGCGTCTGTGCCGCAGCTCTCGTGTTG
TGTTTTCCCGGGTCCTGCTCCTCTTCACCCTCACAGACAC
TTTAGAGGAGGAGGATTTGGCTTCTGGAGGGCAGGGGCAG
CTCTACACCATTCTGCTGGTCAATTCTGGTCGTCTGGCTT
TCCCAGAGTACACCGTACATCGCTCAGCCAGACTCTTTAA
GGACAGGGATGACCTCATCAGATATGAAACTGCGATGCGT
GCGCTTCAGGAAGTGATTGCTGCAATGCAGTCGGGCAGCT
GGGAAGACGCCTATGACCTCTATACTACAGCAATGGCCGC
CTGGCAGGAGATTAAAGATTCCTGTGACTTAAATCATCAA
GAACAGCTGCCTGTGTTTCTGCGCTGTTTCACTGTGGGCT
GGACCTACACTCGCATACTTTCTCGTGGAGTTGAGATTTT
GCAGAGACTTAAGCGCTACGAGGATGCAGTAGAGCAGCTG
AGAAATCTCCTGTCTCAGTCGGTGTATTGTGTAGACAGTA
GGGGGCGCTGGTGGGACAGGCTTGCTCTCAATCTCCAGCA
ACACCTGAAACAGCATGAGCAGGCCATCGGTGCTATCCGG
GATGGACTGAATGACCCTCTGGCCCGAACAGGACATAAGT
TGTCACTTTACCAGCGAGCTTCACGAATGAAGGAGTCTGC
TAGCTTGAAGAAGTATCGTCTGTTGCTCCGGGATCTGCCT
ACTGTCCACGTACAGGATGTCACTCATGTGACGATTCGAG
GCCAGCTCTTTCCTCATGAGGGTGGTATGGGTAAATCAGT
GTTCCTCCGAGCAGCCAGTGAGGATGAAGGCTCTGGAGGA
GGACAAGGGACTGTGTTGATGTGTTCAGTTGAGGATCTGG
CTCTGGAGCACTACAGAACACTTGGATTTGATCAAGGTAT
TCATGGAGAAGGATCTACATTTTCCACCCTGTTTGGACTC
CTCATGTGGGACATCATTTTCATGGACGGGGTTCCTGATG
TCTTCCTAAACCCCTACCAGACGTGTCCTCTGGATTTGCA
CACGGATTGTTTCTATGGCAGTCGGCGGGAGGCCATCGAG
GCTCGTGCAGAGATGTTGCGTGAGGCATCTGTAGAGACAC
TGCAGGATCTGATCGCTGATGTGTGGAGCACGCAGGAGGG
AAGAGTGTGTGCGCTGATAAACTGGGAGCGATTCTCCACG
CCTCAGCAGGCACAGAGTCTAGTGGCATGCCTTGGTGGCC
ACTTCTTGAGTGGTGTGTTCCTCAGAATGGCCAAAGACTA
CAGGCACTGCAGAGGAGGACTTCCAGATCTGGTGGTCTGG
AGTACTTCCAGCAACAAGTATAAGCTGGTGGAAGTGAAGG
GCCCTAATGACCGTCTGTCCCAGAAGCAACAGATATGGCT
GGATGAGCTGCGTAAACTCGGGGCAGATGTAGAAGTGTGT
CACGTCACGGCTACTGGAGCACGAGGAGCTCGACGGGAGT
GAAGCTGCTGTCACTCTCAGAAGGAAAGTTAGAAATGCTT
GAAGCAACACTGGATGGATTTAATGATGCATTAAAGTTTG
ACCTCAATTTGCCACTGATCTGATGTAAGAAAAGAATATT
AATAGGCACTCTAAGGGGATTTATTCCCCATCTGAAGACT
GTTAAATTACCTCATGGCGCTGATTGACTGACTTTTATTA
TTGTGCTCATTGTAAAGTGAGAATATATTTGAATGACTTT
TTTAATGTGACATTTATAGAATAAATCATTTTAAAGAAAT
TAAATAAAAGCATTTTAAAAGGTTTTTGAAATGTTAATAA
TGCTTAAATAGTGATGCAAGACATAAGCACATAATGTTGC
AGCTCGTAAAATAGGATTCCATTATGTTTTGTTATGTCTA
TTATTGTGGTCAAAGAACTATGCATGACCACATTCCTTTT
CACTGCATATTCATTCAAGCATATCCTTCACGTCTGACAG
CCAGAATTAAACATACTCTTTTGTTGCAGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations