Transcript

tph2-201

ID
ZDB-TSCRIPT-090929-3049
Name
tph2-201
Previous Names
  • tph2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000015196 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000015196|OTTDARG00000012840|ZDB-GENE-040624-4 tph2|OTTDARP00000012906 tph2-002 LG_ BX950194.9 Danio rerio protein_coding KNOWN, 2010 bp
GCAATTCCGAAGATGCAACCTGCCATGATGATGTTCTCCA
GCAAATACTGGGCTCGGAGAGGACTATCTTTGGATTCAGC
TATGTATGACCAACAGCACCTTGCATCCTCCATGCTCCGC
AGGACATCCTTTAATCGGATAGATGAAAGACCTGACAAAG
AAGAACAGAAATCCACTCATGACCTTGGGAAGCTGGCAGT
GATTTTCTCTCTGAAGAATGAAGTTGGCTTTCTGGTGAAA
GCGCTGAGGCTCTTTCAGGAGAAGCATGTGAATTTGGCGC
ACATTGAGTCTCGGAGATCAAAGAGACTCACCAATGAGAT
TGAGATATATGCAGAATGCAACTGCACAAAGAAAGAGTTC
AACGAACTGGTGCAACACCTCAAAGACCACGTTAATATTG
TCTCGTATAACACACCTCAACATGTGTGGTCTGCAGAGAC
CGACTGTTTGGACTGTGTGTGTGTTTTGGGTGGATTGCCA
GATGGGGAAGGAATACCATGGTTTCCCCAAAAAATCTCAG
AGCTGGATCAGTGCTCCCATAGAGTGCTAATGTATGGCTC
TGAACTGGATGCTGATCATCCAGGCTTTAAAGACAAGGTC
TATCGGCAGAGGAGAAAGTACTTTGTGGAGGTTGCAATGA
ACTACAAATTTGGGCAGCCCATCCCACGGATTGAGTACAC
TGCAGAGGAAGTAAAGACATGGGGAGTCGTTTACAGAGAA
CTTACAAAACTCTATCCAACTCATGCCTGCCGCGAATACT
TAAAAAACCTTCCTCTGCTGACAAAGCATTGTGGGTACAG
AGAGGACAACATCCCACAGCTGGAGGACGTGTCTCTATTC
TTAAGAGAGAGGTCAGGGTTTACCGTAAGGCCTGTGGCTG
GATATCTCTCACCACGAGACTTCCTGGCTGGACTGGCTTA
TCGAGTGTTTAATTGCACTCAGTATATTCGTCACAGCACA
GACCCTCTCTATACACCAGAGCCGGACACCTGCCATGAAC
TGCTTGGTCACGTGCCGCTCCTGGCCGATCCCAAATTTGC
TCAGTTTTCTCAGGAGATTGGCCTTGCATCTCTAGGCGCT
TCAGACGAAGATGTGCAAAAGCTGGCAACTTGTTATTTCT
TCACAATAGAGTTTGGGCTGTGCAAACAAGATGGTCAGTT
GAGAGTCTATGGAGCAGGTCTACTGTCTTCTATTGGAGAG
TTAAGGCATGCGCTTTCTGATAAAGCAACAGTGAAGGTGT
TTGACCCCAAAACCACGTGCTACCAGGAGTGCCTCATTAC
CACATTTCAAGATGTGTATTTTGTCTCTGAGAGCTTTGAG
GAGGCAAAAGAGAAAATGAGGGAATTTGCTAAATCAATAA
AGAGGCCTTTTTCTGTCTACTACAACCCTTACACGCAGAG
CATCGACTTACTCAAGGACACCAGGAGCATTGAAAATGTG
GTTCAAGATCTACGCAGCGACTTAACCACCGTCTGTGACG
CCCTGGGAAAAATGAACAAATACCTCGGTATCTAAACAAA
CACAGTCCCTCAACAATGCTGTATGATTCAGTTCAGGTGA
ATCATATAGTTCAGTTCATCATTCCTTCTATAACAGTTGT
TGTGATTATCTGGGCTAAACATACTGGCCTTTCCTTGTTA
TTAGGATGTACGTCACATAAACACAGGTGTGAAATGTCGC
AACCAATTAAAAACGGCTATTATTATAATGTATTCAGACA
CTAAAGGAACAACAAAGGAAAAGAATCAAGTGTAGTCTTT
GCCTCTTTGTGCCTAATGTTGTGCTTAATCATACCAGATT
TGTGTTTTATTTTAACTACATACTGCAGTATCTACCAAAT
GAAGGCAGTTGATATTATGTACACATAATAATTCAATGTA
AAAGTCCATACGCATTGTTCCGATGCCAATGCTATAGTGT
ATTTGTATAGTATGTTTGTGGTGCTTGCTTGATTTGTTGC
TCACAAAGCCAACAATCAATAAAACATTATATTTTAGGAG
TTTCTTTTAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations