Transcript

mest-201

ID
ZDB-TSCRIPT-090929-2966
Name
mest-201
Previous Names
  • mest-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000014961 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000014961|OTTDARG00000012661|ZDB-GENE-991111-5 mest|OTTDARP00000012712 mest-002 LG_ CR749763.6 Danio rerio protein_coding KNOWN, 1371 bp
AACAGCACATGTTTCAGCCCATCAGGATAAACAACCGATT
CACACTGCGATAAAGTGCAGAGATCGAGAATGTCAGGCGA
CTCACCTCAGAATGACAGTGAGTGTGGGTCAGCTCGTCGT
GTGAGCAGAGAATGGTGGCTTCACGTGGGTTTGTTGTGTG
TTCCTCTGCTCGCCGTGTATCTGCACATCCCTCCGCCACA
GCTGTCACCTGCGCTTAACAGCTGGCGCACTTCCGGTCAC
TTCTTCACATTCAGAGGCAATGACATCTTCTATAAAGAGT
CAGTTGGAGTTGTGGGAAGCTCTGATGTCCTTGTGTTGCT
TCATGGCTTTCCTACGTCAAGCTATGACTGGTATAAGATC
TGGGATTCTCTGACGCAGCGCTTCAATAGAGTCATCGCCC
TTGACTTCCTGGGCTTCGGTTTTTCTGACAAACCGAGGCC
GCACCGGTACTCCATCTTCGAGCAGGCCAGTGTTGTGGAA
GCTCTAGTTGCCCATTTGGGTTTGTCAGAGCAGAGGATCA
ACATCCTATCACACGACTACGGAGACACTGTTGCTCTCGA
GTTACTGTACAGGAGTGACCACAACAGAAGCGGACACATC
ATTGTAAACAGCCTCTGCCTATCAAATGGAGGTATATTCC
CAGAGACTCATCATCCAAGATTCCTTCAGAAAGTGCTGAA
GGACTCCGGCTTTATTTCACCTGTACTCACTCGTCTGATG
AACTTCCAGCTTTTCTCCAGAGGAATTAAGGAAGTGTTTG
GACCGTACACCCAGCCAACAGAAGCAGAAGTCTGGGACAT
GTGGACAGGCATTCGCTTTAATGATGGAAATCTTGTAATG
GACAGTCTTTTGCAATACATTAACCAGAGGCTGAAACACA
GAGAACGATGGGTGGGCGCTCTAACTTCGACTTTAACACC
CCTGCACATGATTTATGGACCCCTAGATCCAGTTAATCCA
CATCCGCAGTTTCTGCAGCTTTACCAGAAACTAGTGCAGA
GATCCACAGTATCTGTTCTAGATGAGCACGTGAGTCATTA
TCCACAGCTGGAGGATCCCACAGGATTCTTTAATGCCTAT
CTCAGCTTTATCAACTCATTCTAAGCCGGGGGATGATCGG
ATCATTCTGAAGCGAGAAATAAAGTGAAATTATGTTCCAA
ATAAGGTTGAAAACATACAAACCCATTAATATACCGCAAA
GTATTTCTGATGCAAGTCATGTGACTGAATGCATGAAGTA
TTGCACCAAATGCCCAATCATTGCAAGTACTTGTTAATGA
ATTTGCTCATATTGTATGCCATAACTTGTAAATACATTTG
TGTAACAAACATGAATGCTTTTTTTGGAAATAATAAATAA
TTCTTATTATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations