Transcript

mest-202

ID
ZDB-TSCRIPT-090929-2965
Name
mest-202
Previous Names
  • mest-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000014960 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000014960|OTTDARG00000012661|ZDB-GENE-991111-5 mest|OTTDARP00000012711 mest-001 LG_ CR749763.6 Danio rerio protein_coding KNOWN, 1465 bp
TTTTCAGCCTGAGACCTTTGGATCCTTAGCAACCCGACGC
CTGCTCACAGCCAGTTTTAAGGAATGACAGCTGAGTGACA
GACTCTTAATGTCACTCAACAGCACATGTTTCAGCCCATC
AGGATAAACAACCGATTCACACTGCGATAAAGTGCAGAGA
TCGAGAATGTCAGGCGACTCACCTAATGACAGTGAGTGTG
GGTCAGCTCGTCGTGTGAGCAGAGAATGGTGGCTTCACGT
GGGTTTGTTGTGTGTTCCTCTGCTCGCCGTGTATCTGCAC
ATCCCTCCGCCACAGCTGTCACCTGCGCTTAACAGCTGGC
GCACTTCCGGTCACTTCTTCACATTCAGAGGCAATGACAT
CTTCTATAAAGAGTCAGTTGGAGTTGTGGGAAGCTCTGAT
GTCCTTGTGTTGCTTCATGGCTTTCCTACGTCAAGCTATG
ACTGGTATAAGATCTGGGATTCTCTGACGCAGCGCTTCAA
TAGAGTCATCGCCCTTGACTTCCTGGGCTTCGGTTTTTCT
GACAAACCGAGGCCGCACCGGTACTCCATCTTCGAGCAGG
CCAGTGTTGTGGAAGCTCTAGTTGCCCATTTGGGTTTGTC
AGAGCAGAGGATCAACATCCTATCACACGACTACGGAGAC
ACTGTTGCTCTCGAGTTACTGTACAGGAGTGACCACAACA
GAAGCGGACACATCATTGTAAACAGCCTCTGCCTATCAAA
TGGAGGTATATTCCCAGAGACTCATCATCCAAGATTCCTT
CAGAAAGTGCTGAAGGACTCCGGCTTTATTTCACCTGTAC
TCACTCGTCTGATGAACTTCCAGCTTTTCTCCAGAGGAAT
TAAGGAAGTGTTTGGACCGTACACCCAGCCAACAGAAGCA
GAAGTCTGGGACATGTGGACAGGCATTCGCTTTAATGATG
GAAATCTTGTAATGGACAGTCTTTTGCAATACATTAACCA
GAGGCTGAAACACAGAGAACGATGGGTGGGCGCTCTAACT
TCGACTTTAACACCCCTGCACATGATTTATGGACCCCTAG
ATCCAGTTAATCCACATCCGCAGTTTCTGCAGCTTTACCA
GAAACTAGTGCAGAGATCCACAGTATCTGTTCTAGATGAG
CACGTGAGTCATTATCCACAGCTGGAGGATCCCACAGGAT
TCTTTAATGCCTATCTCAGCTTTATCAACTCATTCTAAGC
CGGGGGATGATCGGATCATTCTGAAGCGAGAAATAAAGTG
AAATTATGTTCCAAATAAGGTTGAAAACATACAAACCCAT
TAATATACCGCAAAGTATTTCTGATGCAAGTCATGTGACT
GAATGCATGAAGTATTGCACCAAATGCCCAATCATTGCAA
GTACTTGTTAATGAATTTGCTCATATTGTATGCCATAACT
TGTAAATACATTTGTGTAACAAACATGAATGCTTTTTTTG
GAAATAATAAATAATTCTTATTATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations