Transcript

serpina1l-201

ID
ZDB-TSCRIPT-090929-292
Name
serpina1l-201
Previous Names
  • serpina1l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000004531 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000004531|OTTDARG00000004305|ZDB-GENE-040721-3 serpina1l|OTTDARP00000004119 serpina1l-001 LG_ AL845550.13 Danio rerio protein_coding KNOWN, 1657 bp
AACAGTCTCCCGTCATAAGGACTTTGATGGTGAAAAAAAT
GAGGGGAAATATATTCTGCTGTGCAATTGCTGCCTTGCTG
GTAGCAACAGCCTGGGCGGCACCCCACGATGGCCATGAAG
GCCATGACCATGGTAGCCACACTGCTGACCACCACCACCA
TCTCCACCATGGGAAGGACGAACCCCATCCCAGCCACAAG
GGGGTCGATGCTTGCCACCTGCTCGCTCCGCACAATGCTG
ACTTCGCTTTTTCCCTTTACAAGAAACTTGCATCCAATCC
TGATGCCCAAGGCAAGAACATTTTCTTCTCCCCAGTTGGC
ATCTCAATGGCTTTGAGCTTGCTGGCTGTAGGTGCCAAGG
GCAGCACTCTTTCACAGATTTACAGTGGTCTAGGTTACAG
TGCACTGACGCCTGAGCAGGTAAATGAGGGTTATGAGCAC
TTGCTCCACATGTTGGGTCACAGTCAGGATGCCATGCAGC
TGGAGGCCGGCGCTGGTGTGGCCATCAGAGATGGCTTCAA
GGTGGTGGATCAGTTCCTGAAGGATGCTCAGCACTACTAC
AACAGCGAAGCCTTCGGCGTTGACTTCTCCAAGCCTGAAA
TCGCTGCAGCTGAAATCAACAAGTTCATTGCCAGGAAAAC
CCACGACAAGATAACCAACATGGTGAAAGACCTAGATGCA
GATACGGTGATGATGCTGATTAACTACATGTACTTCAGAG
GCAAGTGGGAAAAGCAATTTGATGCAAAACTGACCCACAA
AGCTGACTTCAAAGTGGACCAGGACACCACCGTACAAGTT
GACATGATGAAAAGAACTGGCCGCTATGACATCTACCAAG
ATCCTGTCAACCAAACTACAGTCCTGATGGTGCCCTACAA
AGGCAATACATCCATGCTGATAGTTCTTCCTAATGATGGG
AAGATGAAGGAGCTTGAAGAATCCATCTGCAGACACCATC
TTAAGAACTGGCATGATAAACTCTTCAGAAGCTCTGTGGA
CCTGTTTATGCCCAAATTCTCCATCTCTGCAACTTCCAAG
TTGGATGATATCTTGATGGACATGGGAATGACTGATGCAT
TTGATTACAAAGCAGATTTCTCTGGGATGACGGAGGAGGT
CAAAGTAAGAGTGTCTCGGGTTCTCCATCAAGCAGTTATG
AGCGTGGATGAGAAGGGCACAGAAGCAGCAGCTATAACCA
CGATTGAAATAATGCCGATGTCCCTGCCACACACTGTGAT
ACTCAATAGGCCCTTCTTGGTACTGATTGTAGAGGACAGC
ACCATGAGCATCCTGTTTATGGGCAAGATCACCAATCCTA
CAGCATGAGGTCCTACTCCAACAAGCCGGACATTTGCATA
ATACTGCCAAACTTTCTGTACAACTCATTGTAAATTGCAA
TAAATGTTGATTTGATTGTTATCAAATTAGTCATCATAAA
AAAAAAACATGTTTTTTTTTTTTAACACTGGTATCAACAA
CTTATTCATTCATTAATTTTCCCTCAACATGATCCCTTAT
TTATGAGGGGTCACCACAGCGCACCACCCCAGCCGGCATT
CTAACCAGTGACTGTCTTACTGTGAAGTGACAGTACTAAC
CACTGAGCAACCATGCTGCTTCTCAACATAACTCTGAATA
AAAATACAGATTTCTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations