Transcript

hipk2-202

ID
ZDB-TSCRIPT-090929-2913
Name
hipk2-202
Previous Names
  • hipk2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000014773 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000014773|OTTDARG00000012528|ZDB-GENE-031125-4 hipk2|OTTDARP00000012580 CH211-1E14.2-001 LG_none AL929229.6,CT025920.8 Danio rerio protein_coding NOVEL, 4147 bp
ATGGCCTCGCAAGTGCAAGTCTTCTCCCCTCACACTCTCC
AGTCAAGTGCCTTCTTTAGCGTGAAGAAACTGAAGGTGGA
GCAGAGTTGCAACTGGGATATGACAGGGTACGGCACGCAC
AGCAAGGTCTACAGTCAGAACAGCAAGCAGAGTGTGTCAG
TCGCCCCTGTGGGCATCAACGGCGCCAGTCTCCAGGTTTC
CAACTCTTCCCTGTCATACGAACAGGCCCTACTCTTCCCG
GCCGGCTCGGGGCACATTGTTGTGGCCTCAGCCAGCAGCA
CGTCTGGGGCAGCTGGTCAACTGTTGGGCAGCACTGGTAG
CAGCGGAAGCGGCAGCGGAGGCCATAACCTGACGCGCCGC
AGCACCGTCAGTCTGCTGGACACCTACCAGCGATGCGGGC
TTAAGCGCAAAAGTGAGGAACTTGACAACAACAACGGCAG
TGGTAGTGGGAGTAGTGTGCATGTGGTTGAGGAGCAGCAG
CCGCCGGCACCCATGATCCAGAACAACGTGCAGAGCGGGG
CCACCGTCGCGACCGCGACTGCCTCCACCACGGCCACATC
CAAGAACAGTGGAGCCAACAGCGAGGGCGACTATCAGCTC
CTACAACATGAAGTGCTGTGCTCCATGACCAACACCTACG
AGGTGCTGGAGTTCCTGGGTCGAGGGACGTTCGGGCAAGT
GGTGAAGTGCTGGAAACGGGGCACCAGTGAGATCGTGGCC
ATCAAGATCCTGAAGAACCACCCTTCCTATGCGAGGCAGG
GCCAGATTGAGGTGAGCATACTGGCACGGCTGAGCACGGA
GAGTGCGGACGACTACAACTTTGTTCGAGCGTACGAGTGC
TTCCAGCACAAGAACCACACGTGCCTGGTCTTCGAGATGT
TGGAGCAGAACCTCTACGACTTCCTCAAACAGAACAAGTT
CAGCCCGTTGCCGCTCAAGTACATCCGACCGATCCTGCAG
CAGGTCGCCACTGCCCTGATGAAGCTCAAGAGCCTAGGAC
TGATCCACGCTGACTTGAAGCCTGAGAACATCATGCTTGT
AGACCCAGCCCGCCAACCCTACAGGGTCAAGGTGATCGAC
TTCGGATCTGCTAGTCACGTCTCCAAAGCGGTGTGCTCCA
CCTACCTGCAATCTAGATACTATAGGGCTCCAGAGATCAT
CCTGGGTCTGCCGTTCTGCGAGGCCATAGACATGTGGTCT
TTGGGTTGTGTGATCGCTGAACTGTTTTTGGGATGGCCTC
TTTATCCCGGAGCATCAGAGTATGACCAGATCCGCTACAT
CTCTCAAACGCAGGGCTTGCCAGCAGAGTATCTGTTAAGT
GCAGGGACGAAAACAACCAGGTTTTTCAACAGAGACCCCG
ACTCCACCTATCCTCTATGGAGACTGAAGACCCCCGAGGA
CCACGAGGCAGAGACGGGCATCAAATCTAAAGAGGCTCGC
AAATACATCTTCAACTGCCTGGATGATATGGCGCAGGTGA
ATATGACCACAGACCTGGAGGGCAGTGATATGTTGGCAGA
AAAGGCAGACAGAAGAGAGTTCATTGACCTGCTGACCAAA
ATGCTGACCATCGACGCAGACAAGAGAATAACACCCATCG
AGACCCTCAACCACCCCTTCGTCACCATGACCCACTTGCT
GGACTTCCCTCACAGCACACATGTCAAATCCTGCTTCCAG
AACATGGAGATTTGCAAGCGTCGGGTGAACATGTACGATA
CAGTCAATCAGAGCAAGACCCCCTTTATAACACATGTAGC
CCCCAGCACCTCGACCAATCTCACCATGACCTTCAACAAC
CAGCTGAACACTGTGCATAGCCAGGCCACCAACCTGGCTC
CCTCTTCCACCAGTGCCACCCTTTCCCTTACCAATCCCGA
TGTCTCCATACTAAATTACCAATCTGCACTCTACCAGCCT
TCTGCGGCCCCCATGGCTGCCGTGGCACCCAGGACGATGC
CCCTCCAGCCCGGTGCACCGCAACTCTGTGCCGCCCGACC
CGATCCCTTCCAGCAGGCCCTCATCGTCTGCCCACCTGGC
TTCCAAGGTTTGCAAGCATCGCCCTCTAAACACACTGGCT
ACTCTGTGCGGATGGAGAACGCAGTTCCCATAGTAACACA
GGCCCCCGGTGCCCAACCTCTGCAGATCCAGCCAGGCCTT
CTGACACAGCAGGCCTGGCCATCTGGTACTCAACAGATTC
TCCTTCCTCCAGCGTGGCAGCAGCTCACACACACTTCAGT
GCAACACGCCACCGTCATCCCAGACTCCATGACCAGCTCA
CAGCCTCTGGCTAACTGGAGGAATTCCCATCCCCATGGCA
GCCATTACAATCCCATTATGCAACAGCCAGCCTTACTGGC
AGGTCACGTCACCCTGCCCCCTCAGCAACCTCTTAATGTG
GGTGTGGCTCATGTCATGAGACAGCCATCCAACAACCAAT
CAAACTCCAAAAAGAACAAGCAGCACCAGATGAACAACAG
GAACGTGTCAGGGTACGACGTGTCCTCCACCCAGCCGGTG
ACGTCACCTCAGCGCTCCAAACGGGTGAAAGAGAACACCC
CGCCTCGCTGTGCCGTGGTTCAAAATGGCCCTCCCTCCAC
CTGCGTCCCATCACAGACCTGCACAGGCGGTGGATGGGGA
GGTGAACAGGCATGTAGCACTACTCGAGACCACCACGGTC
AACACAACCCACCACGCCAAACCATCATCATCCCCGACAC
CCCGAGCCCAGCGGTCAGCATCATCACCATCAGCAGTGAC
ACGGATGAGGAGGATGACCTCAAACAACCCACTAACACCA
GCACATCATCCAAACAGAGGAAGAATGTCATCAGCTGTGT
GACCGTTCACGATTCCCCTGACTCTGATTCCAGCAATACC
AGCCCTTACGCTGTGGACTCCCGGACCAATGGCCCCAACG
CCAATGGCTACGACTCTAAAGGTGCAGTCCTGGATAACTA
CAGCAATGGGAACCCCCGCACCATCATCATCCCCCCGCTG
AAGAGCCAGACCAGCGAAAATCTGGGAGAGTGTGATAGAC
TCTTGCCTGATGTCATGAACCACCAGAACTCCACCTACAA
GTTCAAAACCTCCAATGGAGGCTTCTCTGGCAACAACCAC
ACATCAGGAGGAGTGACAGGAGGTGGGGCATACCGGCAGC
AGCGCACAGGACCACACCCCTTTCAGCAGCAGCCTCTAAA
TCTCAGCCAGGCCCAGCAGCACATGGCAGTTGAGCGTAAC
GGAGGTCACCGGCGGCAGCAGGCATACATCACCCCCACTA
TGGCCACCCAGGCGCAGTACTCCTTCCACAACAGCCCCAC
CCACACGGCTAACGTTCACCCGCACCTGGCCGCTCCACAT
CTGCCTGGGCAACCACACCTCTACACTTACACTGCCCCTG
CTGCCCTGGGCTCCACTGGCACAGTGGCCCACCTGGTCGC
TTCGCAGGGTTCAGCTCGTCACGCAGTCCAGCACGCCAGC
TATCCTCCAGGCATTGTCCACCAGGTGCCTGTAAGCATGG
GTCACCGCGTGCTGCCCTCGCCCACCCTTCACCATGGCCA
ATACCAGGCCCAATTTGCCCACCAGACCTACATCAGTGCT
TCTCCTGTCTACACTGGATACCCGCTGAGCCCCACCAAGA
TGAACCAGTACCCTTACCTCTAAAGCTGAAACACTGGAGC
CCAGCCAATCGCTGCTTACCATTTCTCCCCTTATCCCACC
TAGAGACAGAGAGACATGCTGAAGCCTATCGACCCTTAAC
CCCATCCCCTTGTTCCTGTCATGCTTAAACTTGAAGACAA
TGAAGACGCCGACGGATAGAGGTAGTGTACTCTGAGAGGG
AACAGAAGGGTACTGAGGAACTTTCTTTTCAGATGAGTTT
TATTTCGCCTTCTCAAAAGGGCCAGTTAACGTTTTATTTC
TTGATCTGGAGGTTTTGTTTCTTTTAAAACAGAAGGAGTT
TTGTTTTGTTTTTCTTTCGCAACAAGGTCTCATCAACAGG
CCGTTTGGGAGAGACAGAGTTCCATTCAGCGGAGATTTTG
TTTGCTTTTCGCTTTCTTGAAATCATTCACTGACTGTTGA
GCCGAGGTCACGACGTGGATGTTGTGAATTCCTACATGAT
TTTTTTTTGGATAAGGTGAAATACGGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations