Transcript

s1pr1-201

ID
ZDB-TSCRIPT-090929-2707
Name
s1pr1-201
Previous Names
  • s1pr1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000014056 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000014056|OTTDARG00000012039|ZDB-GENE-001228-2 s1pr1|OTTDARP00000012014 edg1-001 LG_ BX908392.13 Danio rerio protein_coding KNOWN, 2352 bp
TCAGTCAGAGAAAAATTACCTTCACAATCCTCCACACGAG
ACTCGGGCGATGCGATAAACACTACATCTTTGATATCTGG
ATATATTACATCATTACTGCAGGATTACGCGGGCAGGACA
CTCAGTCTGGAGTTTGAAGCATTTCCATGATGCAGTTTTT
GGATTTGTGGACCGCATTCATCCTCTGTAAGGATTTTTAC
CTGACTTGAGAAAACCTTGCTTACATGACATCATACTAAG
AGGAGAACTGGATACCCGGCTTCCCAAGTCCACCAGCACC
CCTCTGTGGCCTGTGGTGGGTTGCACGTTGGATATAAAAC
TACCAAGCCAGTGCAAACCATGGATGACCTAATCGCCAGA
CACTACAACTTCACTGGGAAATTTCGCAAGGTCCACAAGG
ACCCGGGACTCAAAGCGGACTCTGTTGTGTTCATCATCGT
GTGCTGCTTCATCATCCTGGAAAATGTTCTGGTTCTCCTT
ACTATTTGGAGGACCAAGAAGTTCCACAAACCCATGTACT
ACTTCATTGGGAACTTGGCCTTGTCAGACTTGCTGGCCGG
AGTGGTCTATACTGCCAACATCCTGCTGTCAGGAGCCAAT
ACCTACAAGTTGACCCCAACGCAATGGTTCTTCAGAGAAG
GGAGTATGTTTGTGGCCTTGGCTGCATCAGTGTTCAGTCT
CTTAGCCATCGCCATTGAACGACACCTGACCATGTTGAAG
ATGAAGCTCCACAACAATGGCAAGACCTGCCGGGTCTTCA
TGCTCATCAGTACCGTCTGGTTCATCGCCGCCATCTTGGG
CGGTCTACCAGTCATGGGATGGAACTGCATCGACAGCATA
AACAACTGCTCCACAGTTCTGCCTCTCTACCACAAAGCCT
ACATCCTTTTCTGCACCACCGTATTCAGCGTTATTCTCAT
GGCCATCGTCATCCTGTACGCCCGCATCTATGCCTTGGTG
CGCACACGGAGCCGCAAGCTAGTCTTCCGCAAGGTCGCCA
ACGGCCGAGGCTCCAACAAGAGTTCGGAGAAGTCTATGGC
ACTTTTGAAGACCGTCATCATCGTGTTGAGCTGCTTCATA
GCATGTTGGGCGCCGCTCTTCATCCTGCTCCTCCTTGACG
TTGCCTGTCAGACCCTCACCTGCTCAATTCTCTACAAGGC
CGAGTGGTTCCTCGCTCTGGCCGTGCTCAACTCTGCCATG
AACCCTCTGATCTACACCCTGACCAGCAACGAGATGCGCC
GGGCCTTCATTAAAATGCTCAACTGCGGCGTCTGCGTCCA
ACCTTCAGGCAAGTTCTCCAGGCCCATCATGGGTGCTGAA
TTCAGCAGGAGCAAGTCAGACAACTCCTCCCATCCCAATA
AGGACGAGCCTGAATACTCGCCCAGGGAAACCATAGTGTC
TTCTGGGAATATCACCTCTTCTTCTTAAAGGGACTATTCG
TGAACTTTTTCGTCTCGATCTGTAGCATTCGATTGGATGA
GTGTGTGTTTGTGCTGGTCTGGAGAAACTAGGAATTGTTG
GAAGTCAACTGCGATCACATTTAAGACCTGATCTTCTGCT
GCTCCTGACAGACCACCTGTTGAAACTATTCTGCAACTTA
GGGAAGCACTTAACCGAACTGTTACTCCATTATTTTTGTC
GAATGGATTCCTGTAGACAAGCACTTTTCGGGGATTGCTC
CCTGAGAACCAACATAGGCATTACTGACTTTCTCTAAAAA
CGGATTGATGTGAAACGTACTAGCTTGTTGTACTACATTG
TTGAAATTAAACTGAAGAAATGCGGTCGAGAGGTACTTCT
GTTTCTTCGAGTTAACACTATGGTATTAAGATTTATTTCG
CCCCTGATCCAGAATGTATTTTGTAAATGTATTTGGTTTT
TCGTCACCTTTCAACAAATAAAGTGTTGCTGTTGTTGTAT
TAGAGCGTGCATGTACATTAGCTGTCAATATTAATTTATC
TTCAAACAGTTCCAATACATTTGAAACTAGGAGGGATGGA
ACTAAATATTGTGTGTATTAATTGTAAATATATTTTATTA
TTTTACTACGATAGTACGCCATGTATTATAGCTTGTGCAC
ATTGATCTGTTCTGCCGTCCATCGGGGCGGTCATTTTGTC
TTTGCGTGACTCAACTCTTAATGAAATTAATTTGATGGGA
TGGAAAGATGACATGCCACGGTCCAACAGAATATCAGCTG
GTTTATCATAGTAAAGGCTTGTACTCTATTTATCTGTTCC
TCGTAAATACAATCAAATCATGAGCCAGTTTTGTCCCTGT
TCACTGTTGCACATTGTAACATCTAGCCTATGTGTATTTG
TTCTGTTAGTTGTTAATAAATGTTGTTGAAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations