Transcript

rhbdl3-203

ID
ZDB-TSCRIPT-090929-2543
Name
rhbdl3-203
Previous Names
  • rhbdl3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000013512 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000013512|OTTDARG00000011588|ZDB-GENE-050417-2 rhbdl3|OTTDARP00000047957 rhbdl4-001 LG_none AL954746.8,CU137721.9 Danio rerio protein_coding KNOWN, 2931 bp
TGCTGTGGATTTCCAGTGTCAGACTTCAATGAAATATGGA
AGCGAAGAGGAACTTAGTTTGGGATAAACTCATTTACAAT
AAGATGTGACAGAGCTGGAAAAATGCGTAGGTTTACATGA
CGTTCTGAGTTTTCAAAACCAAATGTGGAAATATGTAAGG
GATTTATGAGAACAAAACATCATGGCAGAACTTTATGAAA
GGAGATAATCATTATTTAGATGGACTGAAAGAGGCAGAAG
GAATATGGTAAACTCATCTCCAGCAGTTGCTGCTCATGCA
GAGGGAGAAGAGATCGAGGTGCTGGAGAGCACTGATGTCC
TTCCTGTAGCTCCAGAGGACCAATGGAAGTGTCTTTTTGA
CAAGTATGACCCAGAGAATTCAGGCTTCATCAGTACTGAG
CGTTTCCGAGATCTGCTTGCAGCTCATGGATCAGAACTGG
ACCCTCACAAGCTTGAAGTTCTTCTTGCCCTTGCTGATGC
AAATGCAGACGGAAAGATTTGCTACCAGGATTTTGTTAAC
CTGGTGAGTTCTGCAGATGAACTAAAGATGAGTAACAAGC
GTTCAAACAGTTTTCGTCAAGCAATCCTGCAGGGGAGTCG
ACAGCTCAGGAATTCTGCTTTGAGAGAGGAAGTGGGCTTG
GGTCTGTCTCGGAGACTTGTGCGCCACGTTGCCTATGAGA
CTTTGCCCAGAGAAGTGGACCGCAAATGGTACTTTGACAG
TTACACCTACTGTCCACCACCATGGCTTATGCTGGCCATC
ACTATAACAGAGGTTGTTGTCTTTATGTATTATGGACTGC
AGCTGAATCGCTGGGTTCTGCAGGTATCATCGCCATACTT
CCTGAAGGGCCCATTGCCATACCACCCGCAGCTTAGAGCG
CAAGCCTGGCGCTTCCTTAGCTACATCTTCATGCATGCTG
GAATTGAACACCTGGGTCTAAACATGGCCATGCAGCTTTT
GGTGGGTGTGCCACTTGAGATGGTCCATGGAGCTTTGAGA
ATCGGCCTAGTGTATGTGTGTGGCGCCCTGGCAGGCTCTT
TGGCTGTTTCTGTGACGGATATGACAGCACCTGTGGTTGG
TTCATCAGGAGGAGTCTATGCACTGGTTTCTGCTCACCTC
GCCAATGTTGTCATGAACTGGTCAGGGATGAAGTGTCAGT
TCAAGCTCTTTCGCATGGCAATGGCTCTGGTGTGCATGAG
TGTGGAGTTTGGCCGTGCTGTCTGGCTTCGGTGCTATCCC
CCAGCCTTCCCACCATGTCCTAATCCCAGCTTTGTGGCCC
ATCTGGGGGGTGTGGCAGTGGGCCTCACCCTTGGCGTTGT
GGTTCTTCAAAACTATGAACAGCGTTTGCAAGAACAGTCC
CTGTTCTGGATCTTCTTCAGTGTCTACACACTCTTTATCC
TCTGTGGAATCTTCTGGAACATTTTTGCTTACAATCTCTT
GGATGTCAAGTTACCCCCGCCTCCTTGAAGCACAGAGTTT
GTGTGTCTCAAATGACTAACAAAATAATCTAGCTGTTGTA
AAGGTCATAAATGACTAAACAAATGTTAAGTACCTTACTG
CAGTCCTCCTGCAATGTTCGTGTTAGTGCCTAAACCATGC
CAAGTTCTAGCATCGTCGAAGCGGTTCAAAAGAGCAGATT
GAGATTTCTACGCAGTGATGAGTGTAAATTTGCTGGACAG
GCTGAAAAGCGCTTTTGACATCTTCATACTTTGAGGGCTT
TCAGCAATAGCACAAATATTATTTTCAAAATAAAACTGCT
GCAGGCTTGTCAACTGAGTATCATTAATAAATATCAGTAT
TTTATGAGAACATTTGAATAAGTGTTCTATATTTTTATAA
AAGATAAAGACATGAGGTAGTATGAAAGCACTGATGCAGT
CTGTTGTGTGTGTGAGAAGAATCCTTAAAAGATATTTAAG
AATAACCAAAGTAGCAAGGAAACAAATGAACAGCAAATAA
TTAGTATTACAAATGTTTCAGTGTATCACTCTAGCTGGAA
TGCTTTTTAATGAATCCGATATTATCCAAGGAGACTAACT
CCCCCTCCTCTTCAAAGTTGAATCACTACTGTCATCCTTG
CAGGAAGGGAGTTTGTGGCACCAGAATACAAATCTTAGTC
CTAAAATTGATTTACTAAATTATATATTTGAATCATGTAT
TATAGTAAGAACAATGTGACTTGCAAAAGTGACAAAAAAT
CATTTTGAAAGTCATTTTGAGAGGTATATATGACACAAAA
TGCTAAATTGGTATTGTTATAAGCTGTCTAATATATACAT
GCTTGTATTACTGTAGTTTTGGAATTGTGATTGTGTACCT
CAAATTAACATCTACTATACCTCGAATACTGTAAATGGTC
AGTGTTTTTCTGTTGGTGCTGTAATATTTTTGGAGGTTTT
CTGAGTGTCTGTTCCTCTAGTAACTGGTTTGCACCTTTAA
GTTCTGCCAGTGATTACAGACACTGATCCTGGTACAGCTT
TGTGTTTACTGTGAGTATCTTCTGCCTGTATGTGGCACCA
CTGACTCAGACTAACATGAACAGAGGAAACCCAAAATAAA
ATCCTCTGCTTCTGAAAATTAGTAAATGCAGTACTTTAAT
GCCAGTTTTGTGTCCTGAACAACAGGAAAAGCTTTCACAA
TGTGTATAAGCTACTTTGCCATTTATTTATTGTTTTATTT
TGTTTTGTTGCTTTTTCTATCAAAATGTAATGAAACATGG
AACTTGAAAAGGGCAGTGACACTGGAAATGCGAATGCGTA
TTTCAGCATGCACATATTTTGCAGATTTGAGATGTAAATA
TGGAAAACATTATTGGAAATGACACTTTCACTGATTTCTT
TTATTTCAAATTGTGAAAGAAGTTTTTAAACCTGAAACAT
TTGAAAAAAATGTATATTGTTATTTCAATAAAATGCTTTA
GAAATAGCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations