Transcript

rhbdl3-201

ID
ZDB-TSCRIPT-090929-10715
Name
rhbdl3-201
Previous Names
  • rhbdl3-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028201 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028201|OTTDARG00000011588|ZDB-GENE-050417-2 rhbdl3|OTTDARP00000047956 rhbdl4-002 LG_none AL954746.8,CU137721.9 Danio rerio protein_coding KNOWN, 1549 bp
CACAGTGAACTTTGGCAAAGCGCTCTGTGGATGCTGACAG
GAGTCGCTCCTCTCGGGCGCTGCTGGCACGCGCTGTGGAT
GCGAAACAACAGCAAGGTGACTGTTTAAAGATGTAGACAG
TACGCCACTTGGAACGTATGACCCAGAGAATTCAGGCTTC
ATCAGTACTGAGCGTTTCCGAGATCTGCTTGCAGCTCATG
GATCAGAACTGGACCCTCACAAGCTTGAAGTTCTTCTTGC
CCTTGCTGATGCAAATGCAGACGGAAAGATTTGCTACCAG
GATTTTGTTAACCTGGTGAGTTCTGCAGATGAACTAAAGA
TGAGTAACAAGCGTTCAAACAGTTTTCGTCAAGCAATCCT
GCAGGGGAGTCGACAGCTCAGGAATTCTGCTTTGAGAGAG
GAAGTGGGCTTGGGTCTGTCTCGGAGACTTGTGCGCCACG
TTGCCTATGAGACTTTGCCCAGAGAAGTGGACCGCAAATG
GTACTTTGACAGTTACACCTACTGTCCACCACCATGGCTT
ATGCTGGCCATCACTATAACAGAGGTTGTTGTCTTTATGT
ATTATGGACTGCAGCTGAATCGCTGGGTTCTGCAGGTATC
ATCGCCATACTTCCTGAAGGGCCCATTGCCATACCACCCG
CAGCTTAGAGCGCAAGCCTGGCGCTTCCTTAGCTACATCT
TCATGCATGCTGGAATTGAACACCTGGGTCTAAACATGGC
CATGCAGCTTTTGGTGGGTGTGCCACTTGAGATGGTCCAT
GGAGCTTTGAGAATCGGCCTAGTGTATGTGTGTGGCGCCC
TGGCAGGCTCTTTGGCTGTTTCTGTGACGGATATGACAGC
ACCTGTGGTTGGTTCATCAGGAGGAGTCTATGCACTGGTT
TCTGCTCACCTCGCCAATGTTGTCATGAACTGGTCAGGGA
TGAAGTGTCAGTTCAAGCTCTTTCGCATGGCAATGGCTCT
GGTGTGCATGAGTGTGGAGTTTGGCCGTGCTGTCTGGCTT
CGGTGCTATCCCCCAGCCTTCCCACCATGTCCTAATCCCA
GCTTTGTGGCCCATCTGGGGGGTGTGGCAGTGGGCCTCAC
CCTTGGCGTTGTGGTTCTTCAAAACTATGAACAGCGTTTG
CAAGAACAGTCCCTGTTCTGGATCTTCTTCAGTGTCTACA
CACTCTTTATCCTCTGTGGAATCTTCTGGAACATTTTTGC
TTACAATCTCTTGGATGTCAAGTTACCCCCGCCTCCTTGA
AGCACAGAGTTTGTGTGTCTCAAATGACTAACAAAATAAT
CTAGCTGTTGTAAAGGTCATAAATGACTAAACAAATGTTA
AGTACCTTACTGCAGTCCTCCTGCAATGTTCGTGTTAGTG
CCTAAACCATGCCAAGTTCTAGCATCGTCGAAGCGGTTCA
AAAGAGCAGATTGAGATTTCTACGCAGTGATGAGTGTAAA
TTTGCTGGACAGGCTGAAAAGCGCTTTTGACATCTTCATA
CTTTGAGGGCTTTCAGCAATAGCACAAATATTATTTTCAA
AATAAAACTGCTGCAGGCTTGTCAACTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations