ZFIN ID: ZDB-TSCRIPT-090929-23565
Transcript Name: mir9*-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: miRNA
Annotation Status: miRBASE
Strain:
Non Reference Strains:
Associated with Genes:
SEQUENCE
MIMAT0003156 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>lcl|MIMAT0003156|ZDB-TSCRIPT-090929-23565 LoadedMicroRNAMature mir9*-002 miRNA 21bp
TAAAGCTAGATAACCGAAAGT

Related Transcripts:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
TARGET GENES
Predicted Targets: MicroCosm:mir-9*

Genome Resources: miRBASE Mature:MIMAT0003156 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (5)