Transcript

mir202*-002

ID
ZDB-TSCRIPT-090929-23556
Name
mir202*-002
Previous Names
  • miR-202-5p (1)
Transcript Type
miRNA
Annotation Status
miRBASE
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Target Genes
Sequence
MIMAT0003406 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|MIMAT0003406|ZDB-TSCRIPT-090929-23556 LoadedMicroRNAMature mir202*-002 miRNA 22bp
TTCCTATGCATATACCTCTTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations