ZFIN ID: ZDB-TSCRIPT-090929-233
Transcript Name: ptger2b-001
Previous Name: si:ch211-13n20.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000004220 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000004220|OTTDARG00000004038|ZDB-GENE-040724-267 ptger2b|OTTDARP00000003831 ptger2b-001 LG_ BX284679.5 Danio rerio protein_coding KNOWN, 2330 bp
GACTGAAACCCCACCTCACTTTCGTTTTAAAGTCATGGGC
TGTGCGTAAAAGCTCGCCTTCACTATAAGTTTGGATCTTC
TCTACCATGAAATTTCCCTCATATATATCTCTTCAACCAG
CGCAGAATTAACCCAGGGTTGGACAATAAAGTAACTTTCA
TGGCGTCACAGAACGTCAGTTGCCGCGAGCAGATCAGCGT
CTCTGGAGGATCTCCCACAATACCCGCGTTCATGTTTTCC
ACCGGTGTCCTTGGGAATGTGGTCGCCTTAATCCTCTTGG
AAATGCGGCGGAGGAAACAACCGGCATCTCTATTCCACGT
CCTGGTCTCATCTCTAGTCATCACGGATTTGCTGGGAACT
TTCTCCCTCAGTCCTCTAGTTTTAACTGCGTACTTCAGGA
ACGCGTCTCTGCTCGGGATGAATGAAAATCGGCTGGCCTG
CGGACATTTTGCATACGCGATGACATTTTTCAGCGTGGTG
ACCCTCGCCATTCTTCTGTCCATGGCCGTGGAGCGCTGGC
TCTCCATTGGCCATCCTTTCTTTTACGAGAAGTACTCGAG
TAAACGGTGCGGGTACATCACCATCGCGCTCATTTACCTG
CTGTGCGCGCTCTTCTGCGTCACACCTTTCCTCGGGTTCG
GGAAGTATGTCCAGTACTGTCCGGGAACGTGGTGCTTCAT
TGATATGGACCCGTCTGCGAGCGAACACAAGGCGTTTAAT
ATCATCTACGCGTCTTGTTTGCTGCTCATGATAGTGTGTA
CTGTTTTGTGCAACGCGTCCGTCATTTATCACATTTCGCG
CATGTATAGGAGGCTGAAGGCGCACCGGAGCTCAGTCCGG
CGGCAGCGCGGACACAAGAGACACCGCTCCATGACCAAGG
AGGTTGAACATCTGGTGCTGCTGTGGTTCATGACAATAGC
ATTCGTCTTTTGCTCTCTTCCTCTTGTGATTCAAGTTTAC
CACAATACTCTCTACCACCGAGATCGTCACAGAAACAATG
TCATCCCCCTTCTTTTCCTCTCGGCCAACCCCATCATCGA
CCCCTGGGTGTTCATCATCCTCAGCCCTCCGGTGCCCCGT
CTGCTCTGGGACAAGATCTGTAAAGCTGCAAAATCCAAAC
CCATCAGGGAGAAGGTGCACAGCATTCACCCTGTCCTGTA
CCATTCGAGTCCACCTGCAGACTGAGGAGATAGAGGAGGA
TCTGATGGACATTTGCAGAGCAGTTCCAGGATGCAGCGGC
TCCTGATCTCCAAAAGCTCTCTGTGTTTGTGGGAGAGATT
ATAGAGTGATTGCTCTCTCCTGTAATGAAAAAGTGAATGC
TGAAAGAGCAGGTCACTAGAAACCTGAAAGGATGAGTCTA
AACCTGTGGATGATAAAGCTGGGTGGTGTGTGTGTGTGTG
TGTGTGTGTATGTAGATAAAGTCAAAATTATTAGCTCTTC
TGTGATTTTCTTTTCCAAATATTTCACAAATGATGCTTAA
AAGGGCAAGAAATTTTTCTCAGTATTTCCTATAATATTTT
GTCTTATGAAGAAAGTTCAATTTGTTTTATTTCGGCGAGA
ATAAAAGCAGTTTTTATTGTTTTTAAACCATTTTAAGGTC
AATAATATTAGTGCCTTAAGCAATCATTTATTTCTGATAG
TCTACAGAACAAACCATTGTTTTACAATGACTTGCATAAT
TACCCTAACTTGCCCAATTAACCTTATTAAGTCTTAAAAT
TGCACTTTAACCTGAATACTAGTATCTTGCAAAATCACTT
GAAAAATACTGTTCTGTCACCATGTCAAAGACATTCTAAT
AAGTTAGTTATTAGAAATAAGTTGTTAAAACTATCATATT
TTAAGATATATTGAAACACATCTCTCCTTTAAATAGCTCT
TGGAAATATTTGCAAAAGAGCGTGGAGGGCTAATAATTAT
GATTTCAACTATCTATATATTTATCCACAAAGTAAACGTA
TTTATTATTTTTTTATTTATGGAAAGTAAAGCATTTTTTG
AAGACCGGAAAATACATGTTTATTTATCCATTAGAAACGT
AGTAGTAAATATAAATAAACATTTACTGGCTGACATGAGG
AGCCGTACTTCCTGTTTAAACTATGAGGAATGTGGTTCTC
TCTCTCTTGTGTGTGTGACTTCATGCTTCATCGGTTTTGT
TTTCTACGTTCTGTTGCAAAAATACACAGGACCAGATCAT
GTCTTAGCAAGTCAGTTGATTGTGAAAGACGTACGGCTTG
AATAAAACTGTTGCATGACTGATGATGATTTGGGGGAAGC
TGAAGCAGACTAAACTGTGAGAATAAATGTTTATAAATGT
TTTGAAGTAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ptger2b-001 Contained in:
OTHER ptger2b-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000004220 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK142472 (1) 808bp
    CITATIONS (1)