header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-23201
Transcript Name: ottdart00000001761
Previous Names: busm1-199m19.2-001, dZ199M19.2-001, stat1b-001, si:busm1-199m19.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status: fragmented
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001761 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001761|OTTDARG00000001648|ZDB-GENE-030616-23 stat1b|OTTDARP00000001550 BUSM1-199M19.2-001 LG_ AL596024.5 Danio rerio protein_coding NOVEL, 682 bp
CGCGTATTTTGTCTGCTTATCCTGAGATACACTCCTTTAG
TGACTTGACTAAACGTCCACGTTGAAAGATGACGCTCTGG
AACCAGCTGCAGCTGCTGGACTCAATGTATTTGGAGCAAG
TGGACCAGCTTTACGATGAGGCTTTCCCAATGGAGATCCG
ACAATATCTATGTCACTGGATTGAGAGTCATGACTGGGAA
TCCATTGCAAGTAATGAATCTCTAGCCATCGTTCGCTTCC
ATGAGCTCCTGAACCAACTGGATGAGCACTACAGCCGTCT
CAATCTGGGAAACAACTTCCTCTTACAGCATAATATACGC
AAAATTAAGCGCAATCTACAGGAGCACTTCCAAGAAAATC
CTGTTTACATGGCTATGATCATATCCAGCACTCTGAACGA
GGAGAGAAAGATACTGCAAGTTGCGCTTAGTTCTCAAGGT
AAAGGTGACTCATTGCAGGGGAACATCATGATGGAACATC
AAAATGAGCTGGTCAATAAAGTCAACAATTTGAAGATGAG
TGTGCAGGAAATGGAAAAGCACGTTCAAGCTCTGGAGGAT
ATGCAAGATGATTACGACTTCAATATGAAGAGCCTACAGA
GTCGAATTGAAGCTGAAGGTGTGCAAATGAATGACCCGAT
GCCAAAAGAGATCCAGCAAGAGGAGATGGCAATTAAGCGA
AT

stat1b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ottdart00000001761 682
ottdart00000001848 (1) 1706
ottdart00000056007 (1) 1527
ncRNA stat1b-003 (1) 363
stat1b-004 (1) 812
mRNA stat1b-202 (1) 535
stat1b-204 (1) 3189
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000001761 Contained in:
OTHER ottdart00000001761 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000001761 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BM777493 (1) 666bp
    GenBank:AW422900 (1) 356bp
    CITATIONS (1)