Transcript

ottdart00000001376

ID
ZDB-TSCRIPT-090929-23124
Name
ottdart00000001376
Previous Names
None
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000001376 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001376|OTTDARG00000001276|ZDB-GENE-980526-501 tal1|OTTDARP00000001214 tal1-001 LG_ AL592495.1 Danio rerio protein_coding KNOWN, 2510 bp
TTGTACATTTTCTGGGATCGCGCCGAAGGATGATGGAAAA
ACTGAAATCCGAGCAATTTCCGCTGAGCCCGAGCACGGAG
GGCTGCACATCTCCCCCGCGCGGGGATGGAGACGCGCGCG
GGAAACAGGAAGGCACGACGGCGGAGACAGGAGAGCATCG
CCTCCCTGAGGAGCTCAATGGTGTTGCCAAGGAAACGGCT
CACCACGCCACCGAGCTAAAAAAGGAGGTGGCGGTGATCG
AGCTGTCCAGGAGAGGAGGGAGCGCGGATATAAAAGGCAG
GGAGCTCAAGGCAGAACTCAGCCATAAGGTGCAGACCACC
GAGCTGTGCAGACCCCCGATTCCCTTGCCACTGCCTCCCA
GAGACCCGCTGAGCGACACTCGAATGGTGCAGTTGAGTCC
GCCCGCTTTCCCTCTCCCGGCACGAGCGATGCTCTACAGC
AACATGACGACGCCGCTCGCCACTATTAACAGTGGTTTTG
CTGGAGATGCGGAACAGTATGGGATGTATCCTAGCAATCG
AGTCAAGCGCAGACCTGCACCTTATGAGGTTGAAATCAAC
GATGGTTCGCAGCCCAAAATTGTGCGACGGATTTTCACGA
ACAGTCGCGAGCGCTGGCGACAGCAGAATGTGAACGGTGC
CTTCGCAGAGCTGCGCAAGCTCATCCCAACACACCCTCCT
GACAAGAAACTCAGCAAGAACGAGATCCTGCGTCTGGCCA
TGAAGTACATCAACTTTCTGGCTAAGCTCCTCAACGACCA
GGACGACATGGTCGGCGGTGAAGCTCCCGCCCGGGCCAAT
CGGGATAGCAGAGATGCAACTCTAGTGCGGGACGACCTCC
TTCAGGAGATGCTAAGCCCCAACTCCAGCTGCGGGAGTCT
GCTGGATGGGGACGCCAGCCCAGAGAGCTTTACTGAGGAC
CAGGACTCATCAGTGGAGTCCAGGCCCTCTGCAAGAGGAC
TACACCATTCCAGCCTACCGCTGGACGGAAATGCCCAGCG
GTGACTGATTGGAGACACTGACAGACTAATTTCTCGGGCT
GACAACTAGCGTATGTTCATGTTGTGTGCAAGCATATTCT
TACGTAAGACTTTCTGTTAACGCCCTCCGTGGAGAAACAC
TGGTACGGAGGAAGACCACCAGGTAGATTTTTAATCCACA
CTCCACAGGATCGCCACCTGAAAACGAAAACAAGCAGAGT
GAATGGTACCCACGCCTCATCAGGTACACTGACGGTATGG
AGGTCAGCCGGACTTTAGCGACAAAAATGAGCATTTGAAG
CAAGAAAGTCCAAGAAATGAAGTAGTTCACAGCAAATTGC
CATCATTTAAGCATCTTCATGTCACTCTAAACCACAGGTG
TCAAAGCCAGTTCATAGAGGGTCACAGCTCGGCACAGTTT
AGTTCCAACTTTGCTTCAACATACTTACCTGTAGGTTTTA
AACAAGCCTGAAAGACTCAATTAGTTTGATCACGTGTGTT
TAATTAGGGTTGAAACTAAACTGTGCAGAGCTGCGGCCCT
CCAGGAACTGGCTTTGACTGTGAAACCAATGCAATCCTAT
GGAAATTCGTAACTTTTTGATATAGTGTCTAATTCATATT
CATTTGTGCAGTCTCGTTCCTACATTTTAGTATGATTTGC
TCATCCTCCAATGAGGAGCAGGGCTAAAGTTGGGGTGAGG
GAGCACATTTTTTTTTACATTTGTATGTTTTCATACAAAT
ACAATGCGTAAAATAGTTACGTTTCCTTGTGAGATAGGGC
TGCTGAATCCCAAAAGACGCATAATTGAAAACCCATACAA
TGGAAGTTTAATAGAGGTATAACTCTTGGGATTTCATTGA
CTGGGCATTTTCGGAGAAGGTAGAAAATCGTACATCTGAA
GTGACATGACTGTGAATAAATGATGGCGCAGCTCAACGTC
TTTAAGACAAATTTGTACATACTGGAAATTCAAGTGGGTT
ATGACCTTTAAGTATTCTTAGCGGCATCTGGGGAGAAAAG
TATGGCCATTTTGTAAATGGTTTTTTCAGTATTATGTTTG
GATTACAAGTTTGGATGGTGGAGGAGGTACAGGAACGTGT
ACATAAACCAGGATAATGTTGTGCGTCTATAACGATGACC
CTTTAGACTGTTCTTTTGCATTGTGATCATGGTACACCAT
TAATTCGCATCTCCATTTTCCTATCACTCATTCGTTAGTT
TCTTTGCCCCCTCCAAGCCAAGCATCCCGCAACGACGAAT
CCATTGAGTAAATGTTCTGTCACTTTATTTGACTCGTATG
AACTTGATCTGCTTTTTAGCAGAGGATTGAGTAACCAGTC
TTGGTACCTTTAAGTCTTTTATTGGGTATTAAATGCGCAA
ACAAACAAACAAACATGGTTATTTTAATGTGATATCTAGT
AGAAAGACCTTTGTTGTAAGGTGAAACTCTATCTATGAAT
ATATGCAATGTTATATCTCACAAATTTTATATGAAAAGCC
CACAAAAATAAAAAAACACAAAGCCGAATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations