Community Action Needed: Please respond to the NIH RFI
Transcript

tal1-201

ID
ZDB-TSCRIPT-090929-2012
Name
tal1-201
Previous Names
  • tal1-001
  • ottdart00000011548
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000011548 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000011548|OTTDARG00000010062|ZDB-GENE-980526-501 tal1|OTTDARP00000009955 tal1-001 LG_none BX664601.7,BX322568.13 Danio rerio protein_coding KNOWN, 2643 bp
AGTGCATCTAAAACCTCAGACATGGATGACCCTCCACAAA
ATGGCTCCATGCACACACTAACATCCACCGCCCGACGACG
GTGACCTCGGATGAGAAGCTAAACCGGGATTTACAACTTG
ATTTGGATACCACTTTGTACATTTTCTGGGATCGCGCCGA
AGGATGATGGAAAAACTGAAATCCGAGCAATTTCCGCTGA
GCCCGAGTGCGGAGGGCTGCGCTTCTCCCCCACGCGGGGA
TGGAGACGCGCGCGGGAAACAGGAAGGCACGACGGCGGAG
ACAGGAGAGCATCGCCTCCCCGAGGAGCTCAATGGTGTTG
CCAAGGAAACGGCTCACCACGCCACCGAGCTAAAAAAGGA
GGTGGCGGTGATCGAGCTGTCCAGGAGAGGAGGGAGCGCG
GATATAAAAGGCAGGGAGCTCAAGGCAGAACTCAGCCATA
AGGTGCAGACCACCGAGCTGTGCAGACCCCCGATTCCCTT
GCCACTGCCTCCCAGAGACCCGCTGAGCGACACTCGAATG
GTGCAGTTGAGTCCGCCCGCTTTCCCTCTCCCGGCACGAG
CGATGCTCTACAGCAACATGACGACGCCGCTCGCCACTAT
TAACAGTGGTTTTGCTGGAGATGCGGAACAGTATGGGATG
TATCCTAGCAATCGAGTCAAGCGCAGACCTGCACCTTATG
AGGTTGAAATCAACGATGGTTCGCAGCCCAAAATTGTGCG
ACGGATTTTCACGAACAGTCGCGAGCGCTGGCGACAGCAG
AATGTGAACGGTGCCTTCGCAGAGCTGCGCAAGCTCATCC
CAACACACCCTCCTGACAAGAAACTCAGCAAGAACGAGAT
CCTGCGTCTGGCCATGAAGTACATCAACTTTCTGGCTAAG
CTCCTCAACGACCAGGACGACATGGTCGGCGGTGAAGCTC
CCGCCCGGGCCAATCGGGACAGCAGAGATGCAACTCTAGT
GCGGGACGACCTCCTTCAGGAGATGCTAAGCCCCAACTCC
AGCTGCGGGAGTCTGCTGGATGGGGATGCCAGCCCAGAGA
GCTTTACTGAGGACCAGGACTCATCAGTGGAGTCCAGGCC
CTCTGCAAGAGGACTACACCATTCCAGCCTACCGCTGGAC
GGAAATGCCCAGCGGTGACTGATTGGAGACACTGACAGAC
TAATTTCTCGGGCTGACAACTAGCGTATGTTCATGTTGTG
TGCAAGCATATTCTTACGTAAGACTTTCTGTTAACGCCCT
CCGTGGAGAAACACTGGTACGGAGGAAGACCACCAGGTAG
ATTTTTAATCCACACTCCACAGGATCGCCACCTGAAAACG
AAAACAAGCAGAGTGAATGGTACCCACGCCTCATCAGGTA
CACTGACGGTATGGAGGTCAGCCGGACTTTAGCGACAAAA
ATGAGCATTTGAAGCAAGAAAGTCCAAAAAAAGGAGTAGT
TCACAGCAAAATGCCATCATTTAAGCATCTTCATGTCACT
CTAAACCACAGGTGTCAAAGCCAGTTCATAGAGGGTCACA
GCTCGGCACAGTTTAGTTCCAACTTTGCTTCAACACACTT
ACCTGTAGGTTTCAAACAAGCCTGAAAGACTCAATTAGTT
TGATCACGTGTGTTTAATTAAGGTTGAAACTAAACTGTGC
AGAGCTGCGGCCCTCCAGGAACTGGCTTTGACTGTGAAAC
CAATGCAATCCTATGGGAATTCGTAACTTTTTTATATAGT
GTCTAATTCATATTCATTTGTGCAGTCTCGTTCCTACATT
TTAGTATGATTTGCTCATCCTCCAATGAGGAGCAGGGCTA
AAGTTGGGGTTAGGGAGCACATTTTTTTTAAATTTGTATG
TTTCCATACAAATACAATGCGTAAAATAGTTAAATTTCCT
TGTGAGATAGGGCTGCTGAATCCCAAAAGACACATAATTG
AAAACCCATACAATGGAAGTTTAATAGAGGTATAACTCTT
GGGATTTCATTGACTGGGCATTTTCGTAGAAGGTAGAAAA
TCGTACATCTGAAGTGACATGACTGTGAATAAATGATGGC
GCAGCTCAACGTCTTTAAGACAAATTTGTACATACTGGAA
ATTCAAGTGGGTAATGACCTTTAAGTATTCTTGGCGGCAT
CTGGGGAGAAAAGTATGGCCATTTTGTAAATGGTTTTTTC
AGTATTATGTTTGGATTACAAGTTTGGATGGTGGAGGAGG
TACAGGAACGTGTACATAAACCAGGATAATGTTGTGCGTC
TATAACGATGACCCTTTAGACTGTTCTTTTGCATTGTGAT
CATGGTACACCATTAATTCGCATCTCCATTTTCCTATCAC
TCATTCGTTAGTTTCTTTGCCCCCTCCAAGCCAAGCATCC
CGCAACGACGAATCCATTGAGTAAATGTTCTGTCACTTTA
TTTGACTCGTATGAACTTGATCTGCTTTTTAGCAGAGGAT
TGAGTAACCAGTCTTGGTACCTTTAAGTCTTTTATTGGGT
ATTAAATGCGCAAACAAACAAACAAACATGGTTATTTTAA
TGTGATATCTAGTAGAAAGACCTTTGTTGTAAGGTGAAAC
TCTATCTATGAATATATGCAATGTTATATCTCACAAATTT
TATATGAAAAGCCCACAAAAATAAAAAAAAACACAAAGCC
AAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations