Transcript

hoxb1b-001

ID
ZDB-TSCRIPT-090929-22918
Name
hoxb1b-001
Previous Names
  • ottdart00000001796
Transcript Type
mRNA
Annotation Status
fragmented
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000001796 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001796|OTTDARG00000001682|ZDB-GENE-980526-290 hoxb1b|OTTDARP00000001584 hoxb1b-001 LG_ AL645798.2 Danio rerio protein_coding KNOWN, 1310 bp
GCTTAGAGGTTGTAGGGGCACTGGGACCACACATCAGCTC
ATATTGACCCTGCTTAATCAATTTTGCTTGGTCAGTCAAC
AATGAATTCTTACTTAGATTATACGATTTATAACCGTGGT
TCTAACACTTATAGTTCGAAAGTTGGGTGTTTTCCTGTAG
AGCAAGAATACTTGCCAAGTGCTTGTGCAAGTACAAATAG
TTACATTCCCGAGGGACGGCCAGTCGGAGGAAACACTTTC
ACATCGGCACCGCACGAAACTCATGGCACATCTTACGCAC
AAATTCAATCGCAGCCCTTCCACCTCAACGTGGACATGGG
TAAAACAGGACACAGCAATTTCTGCAAGCAAACCAGACCT
CCTCATTCGGACTATGGACATCAACACGTTCTCACTCAAG
CAGATGACCACATGCGCCTTCAGTCCCCTGGCTTTTCCGT
CGTGAATATGGGAGCCAATATTGGAACTTACAGTGAATCA
AATTGCAGGCCTGGCTCGGTCTCTGCAAGCCACTATCAAT
CATATGCATATGGAGAACCCGAACCACACGGCTATGGTTC
GTTCAGCAAGTATCAGGTCTCCCCTGACAGTGACAGCGAC
TCCAAGACGAACATTAAACAAGCGCCAACCTTTGACTGGA
TGAAAGTCAAGAGGAAACCCCCTAAAACAGTTAAAGTCGC
CGAATACGGAATCCATGGCCAGCAGAACATAATACGCACC
AATTTCACCACCAAGCAGCTCACGGAACTTGAGAAGGAGT
TTCACTTCAACAAATACTTGACCAGAGCGCGCAGAGTGGA
GGTGGCCGCCACACTCGAGCTGAACGAAACGCAGGTTAAA
ATCTGGTTTCAGAATCGCAGAATGAAGCAGAAGAAGCGCG
AGAAGGAAGGCACGGCCCCGGTGATTAAAAGAGTAACCCT
TTGCTCTTCTGGTCAAAACGCAGACCACTCAACTAGCTCA
TCGCCTGGTGCTTCGCCTACCTCGGACTCTTCCACTGCAA
TTTGATGAGTGCCAGACTTTCGTTTCGTTGCTGGAGGACT
ATTTAACTTATTCTGTCGTAGAAAAAAATATTGTTTACGT
GCTATTTGTGTTTTTGTGCTGCATTAGAACTACTAAATAG
ATGCATTAACAGGGTATATGCTTAACGTTCAAATGTTCTT
TTTCTTGTTGTTGTCGTCCGGTCAATTATTTTGCACTACA
GATTCATTCCTCTGTTGAAAGAGTAATAAAATGTGAAAAA
GACTGACATGTTTATGTATTTCGAATATATTAGGACCTGT
GACCTGATAAATAAATATTTTATTTTTCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations