Transcript

crygs2-002

ID
ZDB-TSCRIPT-090929-22809
Name
crygs2-002
Previous Names
  • ottdart00000034092
Transcript Type
ncRNA
Annotation Status
fragmented
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034092 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034092|OTTDARG00000018285|ZDB-GENE-050126-3 crygs2|no_translation crygs2-002 LG_ BX511265.13 Danio rerio protein_coding KNOWN, 478 bp
GACCAGCCTAAATACAAAATTCAAGATGGGCAAGATTGTG
TTTTTTGAGGACAAGAACTTCCAAGGCCGTCGTTACGAGT
GCGATAGCGACTGCTCCGACTTCCACACCTACCTGAGCCG
CTGCAACTCGATCCGTGTGGAAAGCGGCGCCTGGGTGGTT
TATGAGCGGCCAAACTACACGGGGAACCGCTACCTGCTGA
CCAGGGGCGAGTATCCGGAGTACCTGGGCTGGATGGGACT
CAATGACTGCCTCAGTTCCTGCAAGATTATCCGCTTTGTA
AGTTCAGCTATTATCACTGCATCAAATATTGGGTTATGCT
TTATTTTGACAGTCTAATATTCTGAGGGACGCCGAATTAA
TATTACCTGAAAGGGGTGTTCTCAAAAAGTGGCTTTTTGC
AGTTCTCCAATTTCTATTAAATTATGTGGTTTAAATACAG
CATTTGTGACATAGCAAGCACGAATCTTTGCTGCATTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations