Transcript

crygs2-201

ID
ZDB-TSCRIPT-090929-22498
Name
crygs2-201
Previous Names
  • crygs2-001
  • ottdart00000022154
Transcript Type
mRNA
Annotation Status
fragmented
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022154 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022154|OTTDARG00000018285|ZDB-GENE-050126-3 crygs2|OTTDARP00000018582 crygs2-001 LG_ BX511265.13 Danio rerio protein_coding KNOWN, 904 bp
GACTACTTCCTCCTGACCAGCCTAAATACAAAATTCAAGA
TGGGCAAGATTGTGTTTTTTGAGGACAAGAACTTCCAAGG
CCGTCGTTACGAGTGCGATAGCGACTGCTCCGACTTCCAC
ACCTACCTGAGCCGCTGCAACTCGATCCGTGTGGAAAGCG
GCGCCTGGGTGGTTTATGAGCGGCCAAACTACACGGGGAA
CCGCTACCTGCTGACCAGGGGCGAGTATCCGGAGTACCTG
GGCTGGATGGGACTCAATGACTGCCTCAGTTCCTGCAAGA
TTATCCGCTTTACGAGTGGAATGCAGTACAAGGTTCAGTT
GTACGACAAGCCCGACTTCACAGGCCAGGCTATAGAGTCC
ATTGAAGACTGTCCATCAGTGCAGGAGAGGTTCCGTCTGA
GAGAGGTTAATTCCTGCAAAGTTCTGGATGGATACTGGAT
CTTCTATGAGCATCCCAACTATCGTGGCCACCAGTACTTC
CTGGAAAAGGGCAACTACCGTAAACCAGTGGACTGGGGCG
CAATCTGTCCCAGCGTGCAGTCTTTCCGTCGCTTTACAGA
GTGATGTTTCTGTGTCACAGTGCTTGGGCTATATCAACTC
GAAGTTCCAGCTCAAATAAAAGTTTGGTTAGAGACTCACT
CAGCAGCACATTTGTTGCTTGTTTGTGGTTTGTACTTGAG
TGCTATGACTAAAATCAAAAGCAAAGTATTGGTTTAAGAT
CCACAGTAACAGGATGAAGGTTGAGGTGAGTTCCAAATGA
GAAACAGTTTCCACCTCCACCAATCAGCACCAGCTCGGAT
CCTTCACAATCCAGCAACTCAGAGCAGAACGAATGCAGCA
TCAGAGGCCAAGGCACAGACAACTGAAACAATTAGAAACA
GAGATAAATCATGACAACAAATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations