Transcript

agrn-202

ID
ZDB-TSCRIPT-090929-21880
Name
agrn-202
Previous Names
  • agrn-001
  • ottdart00000042139
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042139 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042139|OTTDARG00000030427|ZDB-GENE-030131-1033 agrn|OTTDARP00000033553 CH211-203J19.2-001 LG_none BX539346.9,CU062415.7,CR456641.8,CR450795.8 Danio rerio protein_coding KNOWN, 8434 bp
TTACTAATTCACCAAGCTGTGGAGATCTGCGCTTGTGGAT
TTAAAGTACAAAGTGCAGTGGGGATTGTTTGCACTCACTT
GTCCGAGTTGCCAATCTAGGCCAGGGGTCCAGTGGAGCTT
TTGTCAAACACACTTGAGAGAACTTACACACTAACCTTTC
ATGACAAATCACCGATGCTTGGGAAAGAAATGGAGGGATT
GTCGGAAGGTTAGGGACTCTAGGACCAGTACCCTACCAGA
GAGGCTGTAATTTGGGAACAAAATGCGTTGCTTGGAGACT
GGTGAAAGCATTCGTCTACGTTTTTCAGGAAGGAACTGCG
ATAAGAAGCATCACCGGAGTTTTAGCTGAAACCCTTTTTG
GATTTCTTTTGTCTACCCTTTTTCTCTGAGTCTGTTTGGA
ACGCTTGCCAACTTGGCGTACTTTAGGGAAGGCGCGGAGT
GGAGTATGACCAGTTGTCAGTACCCCACGCCGCCCCCAGA
GCGGGACCGCATGTACCAGCACAAAGTGTCGCTGGTCGTG
CGATACTTCATGATTCCTTGCAACATCTGTCTCATACTGC
TGGCCACATCCACGCTCGGCTTTGCTGTACTCCTCTTCCT
CAATAACTATAAACCTGTTCACTTCACACCGGCACCTCCT
CCTGATGGTTGCAGAGGGAAGTTGTGCGGATTTGGAGCGG
TGTGTGAGAGAGACCAAGCTGACCCATCTAAAGGAGAGTG
TGTGTGTAAGAAGATTGTGTGTACATCTGTGGTGGCGCCA
GTGTGCGGATCTGACTCCTCCACCTATTCCAATGAGTGTG
AGCTGGAGAAGGCTCAGTGCAATACACAGAGACGCATCAA
GGTGATGCGCAAAGGCCCCTGCGCCCTCAAGGACCCGTGC
AGTGAGGTAACCTGTAGCTTTGGCAGCACCTGCATCCAGT
CATCGGATGGTCTGTCCGCCAAGTGTATGTGTCCTCTGAG
CTGTGAAAACGTCCCCAAGCATGTGGTGTGTGGCAGTGAC
GGCCTGGACTACCAAAGCGAATGTGAACTCAACATGAAGG
CCTGCGCCACTCAGAAGAACATCCGTGTGCATCACCAGGG
CCGCTGCGATCCTTGCAGTGACACTCTGAACAGCTTAAGC
ACAGCCTGTCGAGTCAACCCAAAGACCTACCAGCAGATTA
CCTTTGCCCCGGCTGAGTCTTGTCCGCCTGACGAAATGCC
CATCTGTGCCAGCGACGGACACACCTACGAGAGCATGTGT
CAGATGGAGCGCACTGCCCTGAAGAACAACCTGGAGCTCA
AAAAGGTCTCTTTAGGCAGCTGCAAGGAAAAAGGGGGCTG
CCCGAATGGTTGTAAGTTCAACGCCATATGTTTGCTGGAT
AATGGAGAGTTTCGGTGCTCCTGCGATCCCATACAATGCG
ACGGCACGTACAAGCCCCTGTGCGGAAAGGATGGCAAGAC
ATACCCCAACGACTGCGAGAGGAAACTGCAGGAATGCCGG
ACCCAAAAAGACATCCCTGTCAAACAACAAGGGCCCTGTG
ATCTTAACCTGGAGAGCCCCTGCCTGAAGAAGACCTGCGA
GTTTGGAGCCGTGTGCGTGGTGAAGAACAGCGAAGCAGTG
TGTGAATGCTCAGACGCCTGTCCGCAGGACCAAGACCCTG
TTTGCGGCAGCGATGGGCACACGTACAGCAGCTCATGTCA
AATGAAGGCCATGGGATGCGCTCTTCAGAAACAGATACAG
ATGCAACACAAAGGACCATGTGCAGATGAGTCCTGCACCA
ACTGCTCGTTTGGCGCGATCTGTGATGCCCAGACTGGCCG
GTGCGTGTGCCCTAAAGGCTGTTTGGAAACACGGCAGCCC
GTATGCGGCAGCGACGGCACCACGTATGACAACGAGTGCA
AGCTCAACGTCCAAGCCTGCACTAAACAGCTGGATCTCAA
GGTGGTGGCCCATGGAGAATGCAAAACCTGTGGCAGCACT
GTGTGTAGCTGGGGGTCGCAGTGCGTGAACAACAAGTGTG
AGTGTCAGCAGTGCACTGGTCAGCCGGTGAAACCCGTGTG
TGGCAGCGACGGCAACACATACAACAACGACTGCGAGCTG
AGACTGGCCTCCTGTCAGAAACAGAGGAAGATAGAGGTGG
CCAAGCCTGGCGTCTGCGATGAAGACTGTGGTTCAGGAGG
CTCCGGCTCGGGATCTGAGACTTGTGAACAGGACCGATGT
CGCCGATATGGAGGAACGTGGGACGATGACATGGAGGACG
AGCGATGTGTTTGTGAACTAAACTGTCAGATTGTGCTGCA
CAGCCCGGTGTGCGGCTCTGATGGAAACACGTACTCCAGC
GACTGTGAGCTCAAGAAGACCAGGTGCGAAAAGCAAATAG
ACCTGAGTGTCCAAAGCCAAGGGCCCTGTCCAACTATCGT
ATCACCACCTCCAGAGCTTGTTGCCTCCCAGCACTGTAGC
CAAACAGTTTATGGATGTTGTGAAGATAACAAGACCGCTG
CCCTGGGTGTTGGACTGGCTGGATGTCCTAGTATGTGTCA
GTGCAATCATTACGGCTCATACGGAGGCACATGTGACCCC
TCGACTGGCCAGTGTTCCTGTAAACCTGGTGTCGGTGGAC
TGAAGTGCGACCGCTGTGAGCCCGGATTTTGGAACTTCCG
TGGCATTGTCACAGAAAACATGAGCGGCTGCACACCGTGC
AACTGTGATGGAGTGGGTTCGGTTCGTGATGACTGCGAGC
AGATGTCAGGCCTGTGCTCCTGTAAGCCTGGAGTTAAGGG
CATGAAATGCAACGTGTGCCCTGATGGCAGCAAGATGGGA
GTCAACGGCTGTGACAAAGGACCTAAGGCTCCCAAGTCCT
GTGCTGAGCTTGTGTGCCACTTTGGGTCTTCATGCGTGGA
GGTGAATGGACAGGCTCACTGTGAGTGTCCTTCACCAGAT
TGTGATGAGAAAAACAAGACCAAGGTATGTGGTTCTGATG
GGGTCACCTATGCAGACCGGTGCCAGCTGAAGACCATCGC
ATGCCGACAAGATAAAGAGATCAAGGTGGAGCATTTAGGC
CAGTGTAAAGAATCCATTGAGCTGACGGCCAAACCCACCC
CCTTCCCAACCACCCACCGCACCACCCCTCCCACCGCTCA
CGTCAAGGTCACCAAACAGCGACATGGCCACCGCACCACC
ACTCCGGACAGCTATGTGGTGGAGGCAATGCCTCCACCGA
GGTTGGATGGAGCGCGAAAGTTTTCCAGCCCTTTCACCAC
CCACCGTCCCACTACACCCTACAAACCACTCCGCACCTCA
TCCCCACCTCTGGACTTTGACGAGTCGGGCAGTGGAGAGC
CCAGTGGGGATGATGAGATGGTGAGCGGAATGGAGGAGAG
CGGAGAAGAGCCACTTGGTACAACAGTAGCTACTACCACT
CTTCCCACAGCTGAGGAGCGATCGTCCTGTGACAACACAG
CGTTCGGCTGCTGTCCCGATGGGAAGACGGCCGCCGTCAA
CTCAGAGGGCACAAACTGCCCATCCACCATGCGTTTCAGC
GGCTTCCTGCACCTGGATAAGGTTGAGGGTCAGGAGGTCT
TCTACACGCCTGAGATGGAGGACCCCAAATCGGAACTGTT
TGGTGAAACGGCCCGAAGCATCGAGAGCGCTATGAATGAG
TTGTTCCGCAAGTCTGATGTCCAGAAAGACTTCCAGAGTG
TCCGTGTGAGGAATCTATCCCCCAGCAACTCCATAATAGC
ACATTTCGAGGCTCACTTCGACCCAGACACAAGGTTCAAT
GTGGGGGATATTGAGGGAGCCCTTCTCAAACAGCTTAAGG
CGTCTAAAGACACTGGCATCGTTGTGAAGAAACCAGAGGA
AGAGAACATTCGCATCAACAACTATGGTCTTTCAACTGTT
CCTTTCTTTACCACCACAACAACCACTGTGGCATCTGTCA
CGACTCCCACTACCACCACCACCACAATGTCTCCCAGTTC
TGCTTATACCACTCTCCGGCCCATCACTACTAGACGACCC
TTCACAAGAACCACCACGCCAGCACCAGCCACCACCACTG
CACCACATGTGCCCAAGACCACAGTTTCGCTTATGAACAG
ACTAGGGCCCCACGCTCACAGTCCATGTGACTCTCAGCCC
TGCCGACATGGAGGAACCTGTGAAGAAGACGACAATGACT
TCACCTGTATCTGTCCAGCAGGACGAGGAGGAGCCGTGTG
TGAGAAAGTTATAAAGTACTTCATACCATCCTTTGGTGGA
AAGTCTTACATGGCGTTCCAGACCATGAAGGCCTACCATA
CTGTACGCATTGCCATGGAGTTCAGGGCTTCGGAAATGAC
TGGGATATTGCTCTACAATGGGCAAAAAAGCAAAAAGGAC
TTTCTTTCTCTGACTCTAGTTGAAGGATATGTGGAGCTCA
GGTTTAACACTGGTTCAGGGACTGCTTCAGTTATCAGTAA
AGTCCTGGTAAAGCCGGGTCGCTGGCATCAGCTTGTTGTA
GTACGTAACAGGCGCAATGCCATGCTGAGCGTGGACAATG
AGCCCAGCGTTGAAGGACAAAGTCCTCCAGGAACAGATGG
ACTCAACCTGGACACAGACCTTTTCATCGGCGGAGTGCTT
GATGACATGAGTGCAGACGTAAAGGAGAGGACATCAGTTT
CAGCAGGTCTGGTGGGCTGCATCCGCATGCTGGACGTGAA
CAACCTTGTCTATAATCTGCAAGAGAATGGCGGCAGCGTT
CTGTACGGTTCGGCCATTGGCGAGTGTGGCAACAACCCAT
GCCTGCCAAACCCCTGCAAGAACGGAGCGTCCTGTCAGGT
CAAAGAAGCCGAGATTTTCCACTGCAAATGTGTCAACGGT
TTCTCTGGCCCGACCTGCGCTGATGCCCACAATCCCTGCG
ACCCCAATAAATGCCACCCGCCATCACGGTGCCAGGTCCT
TCCAGAGGGAGGTTACAAATGCGAATGTCCGATGGGACGT
GAAGGCAGGCACTGTGAAAAAGTGTCAGACAAGGGAGGCG
CTTTCATTCCTTACTTCACTGGAGATTCTTTTCTGGAGCT
CAAAGGCCTCCATACGTATAACCAGGATCTCAGGCAAAAA
TTCAGCATGACTATCGTTCTACTGGCCAATGACTCCAAAG
GCATGATCTTCTACAATGGTCAGAAGACAGACGGCAAAGG
GGATTTCATCTCGCTCTCTCTTAATGACGGCATCCTGGAG
TTTAGATATGACCTGGGCAAAGGGCCAGCTGTCATTAGGA
GTAAAGAAAAAATCAAGCTGAACGAGTGGAACACAGTGAA
TTTGGAACGGGCCAGCAGAAAAGGAGAGATTAGCATTAAC
GGCAAAGACCCTGTCAGAGGAGAGGCGCCGAATCAGCACA
CGGATCTCAATCTGAAGGAATCGCTCTTTGTGGGTGGAGC
TCCTGATTTCCGCAAAGTAGCCAGAGCTGCTGCGATCAAA
GATGGCTTCAAAGGGGCCATTCAGAAGATTACTTTGATGG
GAATTCCAATCCTGAAAGCTGATAATGCCCTTTCGTCCAC
TGACGTGTCCATGTATCCTAATCATCCCTGCTCCAAAGAC
GTTTGTGAGAATGGAGGCCGCTGCAACCCCCAGCTGAACA
GCTATGAGTGCGCCTGCCGCCACGGATTCTCCGGACACCA
CTGCCAGGACACAATATTTGAGAAGTCCGCTGGGGACACG
GAGGCCATTGCGTTTGATGGTCATACATTCATCGAATATC
ACAACGGAGTCACCAAAAGCGAGAAAGCCCTGCTGGTGAA
TAAATTCGAGCTGAGCATCAGGACGGAGGCTACGCATGGT
CTGATTTTGTGGAGCGGAAAGGGAGTTGAGCGCTCTGACT
ACATCGCCCTCGCCATTGTGGATGGAAGAGTACAGATGAC
CTATGACCTCGGCTCCAAGCCTGTGGTGCTGCGCTCCACT
GTACGGGTCAACACCAACCACTGGATACGAATTAAGGCCA
GCAGAGCGCTCAGAGATGGCTCTCTGCAGGTTGGTAATGA
GGCAGCTGTCACTGGGTCTTCACCCTTGGCTGCCACACAG
CTGGACACAGACGGGGCTCTCTGGTTGGGTGGACTGGAGG
AGCTGTCTGTGGCTCGACGGCTGCCCAAAGCTTACAGTAC
AGGCTTCATTGGCTGCGTCAAAGACGTGATAGTGGACGGC
GTGGAGCTGCATCTGGTGGAGGACGCCTTAAATACTCCCA
AAATATCACACTGTTCTGCCAAATAATCTGGCAACGCGCT
CCTCCCAACACCATGTCTACTGCTGTAATTATTTTTTCTA
TTTTTTGTATACTTTCCTTTCGCCTTTTATATTGGAAAAC
AAAAAAATTACATTGTTTTAATTACACTTTTGTTTGTTTG
GTTTATTTTCATCCCCTCCCCCCTGTCTTTGCGTCCAACC
CGTAATCGTGCTCTCATTCGGCGAACATGGTGACATAAAG
ACTAGCAAAAAGTCCCATTTACGTCTGTGCTGTTTCTACG
GTAAACACCACGATCATTACTTGAACAGTGGCAGATGAGA
TTCAGGATTGCCTTTTCTCAGTGCCATAACATGATCCATT
CATTCCTCTGAGCTGCTGTCGCTGTGCTCCTTGCTACGTT
TTAAAGGTCTAAAAAATAAACAGCTTTCTGCTTTATCGAC
AGATGACAGCAACTGTTAAATACACCGAGCAAGACTATGA
AACCACTAACGAGTAGCTGACGTAACATTAGCATTCCTCA
AAAATCACGTCATTGACCTGTGAGATGTTATAAATATTGA
TGAAAAATACACGAGACTGTGACTTTTTGAAGATGCTATT
TTTTTTTTTTTGGTTGCTATCATTCATGTGTTGTGCATAT
CTAAAATATAAATATATATAGAGAAATACATATATGCTAT
AAGACCACTTGTTGCATGCATCTTTTTAGAAGTGTTGGGT
TGATTTTGCCTCAGTTTTGTTTTGTTTTGTTTTGCTCATC
ATTCCATTCAGGGCAGAAATGTAGCTGACTACATTGCAAT
TTTGACATCTGGTTATTTCAATTTGGGAGATTAATTTTAT
ATCTGCTATTTGTCAATCTGAGCAAATTGTGAGTGAGTGT
GTGTGTGTGTGAGTGGATGTGTTGGAAAAAACGGTTGTTG
CAAGAAGTCAACTCTGGGAGGCGCTGTAACACAGGAAGAG
ACTTAAAACACATAAGGTGGACAAACAACGAAAGAAAAAA
ACATTGACATTCTTGGCATGCTTCATCATCGAACAAATTT
CACTACACTTTTTTTCCCCCCTATTGTATCTTATCAAATG
TCGCTTTAAAAATGCTGCCAGCACTTGCTATGTAAAAAAG
GGATGATGTATGTAAACCCCCCTTGCATCCTGTTCAACAT
GTTCGGTAACCAGTGAAAATAGTAATGCATGGGTTTGTCA
AGTCAAAATGGTTTTGTAAACCTGTTCCGAGACAAATGCA
ATGCTGTGGTGCTGTTCGGTGTGAGAAATATTATGAGTTT
GATACCTGATGCTTTGCAATATTCCACTACAAATATGCCT
GTTTAGGGTAAAGTATCTTTTTTGTTTTTGTTTTATTTTT
TTTTAACAAATCCTCTTTGGACATGCAAGATCATAATCGT
CATCATGTACAGCCCTGTGATTTTCAAGTGTAAATTTGTT
ACTGAGTTTCTTTTTCTTTTTTTAGTATTATACACTGGAA
GTGAGTTATGGGATACTGGGAATAATGGATGATTTTTTTG
GGTCGTCACAGGATGTCATGTTACTGCACGAGACGTATGG
ACCGTCCACCTTTTTTTTTAGTATAGCGCTTTCACCTTCA
CTTTTCCAGCAGACTGGATTTCTGATCTTTCTTTTTTTTT
TTGTAATTTTTTTTTGCTTTGTTTTTTGACATCCTCCTCC
AGTAGCTTTTGCTCTCAAGGGAAGCGAGAACCGCATTGGA
AAACCTGCTGTGTGAATGGAAACTGAGAAATGCCTTAAAA
TCATTCACCGTTCACAGGTGACAAAAGTTCATGTCCATAC
TGTTCTGTGCTCTCACTTCTATTAGCCTCATCATGTAAAT
TAATTCATAAATGTTAATAAATATATTAATAATAATGCGT
AAGAGAATTTCCAGAAGGCCTCGATAATAGTGGTTCTGGA
CTCTACAAGAATACTATTTACTGTACAAATACTATTTTCA
GTATCTTATTTATGTCTTAAGAGGATTCTCAGTCTGGCAT
TTGTAAACTATTGATTGATTGATTGATTGATTGACTGACT
GATTGATTGATTGACTGAACTAGATCTGATGGGCAGTGCA
GAATGAGAGGCATGACGTTACCATTACTAACTTTATTACT
TGTGTCTTGTGTTCCTCCAACCACCATACAAATAAAATGT
AAAACAAACTGATCTGACTACTGTAACACTTACTCCTGAA
TAATGTCTGTGAATAAATCCCTCCAGTTCCCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations