Transcript

prss12-202

ID
ZDB-TSCRIPT-090929-21610
Name
prss12-202
Previous Names
  • prss12-001
  • si:ch211-152j23.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041754 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041754|OTTDARG00000030201|ZDB-GENE-090313-45 prss12|OTTDARP00000033315 CH211-152J23.2-001 LG_ BX511095.9 Danio rerio protein_coding NOVEL, 5200 bp
GCTATAGAGCACATGCACGCATGAGTCCTCTGTCACGTCT
GGTGGTGTCTGTAGTTCACTGGCAGACTGTGGGCTGTGAA
GGACAGGAAGATGACTTACTGCAATGCAATCGCACCGTCT
GGAACGGGGGAGAGTGTGAGAATCGCCAAGCGGCTGCTGT
TTCTTGCATGCCGGTGGAGACTTCAGTGTTTGTCCCAGTG
CGGCTATCTGGTGGTCCATCGGCATATGAGGGCAGAGTAG
AGGTGTATCATGCAGGACAGTGGGGCACAGTTTGTGATGA
CCAATGGGATGATAACGACGCTGAGGTGGTCTGCAGGCAG
CTGGGGTTAGGTGGCATTGCGAAGGCTTGGGTGGGAGCGT
ATTTCGGCGCAGGCTCTGGGCGTGTGTTTTTGGATGAGGT
GAGCTGCACCGGAAATGAGCTTTCAATAGAGCAGTGTCCA
AAAACTGCCTGGGGGGAGCATAACTGTGACCACACAGAGG
ATGCTGGAGTGTCCTGTGTACCACTTACAGACGGTGCAGT
GCGTCTGGTTGGGGGTGTAAAGGGTTATGAAGGGAGACTG
GAGGTCCATTACAGAGGACAGTGGGGGACTGTGTGTGATG
ATGGCTGGACACAGACTAACACACAGGTCGTCTGCAGGCA
GCTGGGTTTCAGGTCAGGGGAGAGTGTATCAGCAGGGCGG
TTTGGGATAGCGGCAGGTCCTGTTCTTCTGGATGATGTGC
GCTGTACTGGAAAAGAGCCCACGGTCACACACTGCAGCCG
GAGGGGTTGGTTTAAACATGACTGCACTCACAGACAGGAT
GTAGCCATTGTGTGCAGCCCCCAATGCTCCAGACATGGAG
TACCCAACAGTTTACCTGTGAGGCTGGTGGGCGGAGAGAA
TGAGAGAGAGGGGCGTGTAGAGATCCTGGTGGGTGGCCAG
TGGGGGACGGTGTGCGATGATGGATGGACGGATCGGGACG
CAGAAGTGGTGTGCAGACAGCTGGGTTACAGTGGGCTGGC
TAAAGCTCGTGTAATGGCATATTTCGGAGAAGGCGAAGGT
CCTATCCACATTGACAATGTAAAGTGTACAGGCGGGGAGC
ATTCCCTGACTGACTGTATCAAACAGCCATTCGGGACACA
CAACTGTCGCCATAGTGAGGATGCCGGTGTTATTTGTAAC
TATGGGTTACAGCAGGATTCTCCTGGGGTCAAAGAGGCAG
TTGGCTCCATGTGTGGTCTAAGACTCTCTCACACACGTCA
GAAGAGAATTATAGGAGGAGAAAACTCTCTACGTGGTGGC
TGGCCGTGGCAGGCAGCTGTGCGTTTACGGGGTTCTCAGG
CAGATGGACGCTTGGTATGTGGAGCTACTTTGATCAGCAG
CTGCTGGATCCTCACTTCAGCTCACTGCTTTAAGAGGTAT
GGGAACAGCACAGGGCTGTATAAAGTTCGTGTTGGTGATT
ATCACTCTCTGGTCCCTGAGGAGTATGAGGAAGAGTATGC
CGTGGAGAAGATCGTCCTTCACCCACGCTACCATGCAGAC
AGTAGTGACTATGACCTGGCACTTCTGCGTGTTTCTGGAC
ACAGAGCTCACAGGGGTGTCACGGGCCAATGCGTCACACT
GAGCCGATCAGTGCTGCCCGCTTGTTTACCAGTGCGGAGA
GAGAAAGTGCCAAAGGGCATTGCCAACTGCTACATCACAG
GCTGGGGAGATACAGGTCGTGCATATTCCAAAACTCTCCA
GCAGGCCTCCATTTCTGTGTTGAGCAAGCGTCAGTGTGAG
CAGCGCTACTCGGAGCAGTTCACCAATCGTATGCTGTGCG
CCGGCTCGTCCCATGATGCCCAGCGTGTGGACTCCTGCCG
TGGCGATAGCGGTGGTCCGCTGGTGTGCGAGAGGCCAAGC
GGGAGCTGGGTTGTTTATGGGGTCACATCATGGGGTCACG
CGTGTCGCCTGCAGGAAGCACCCGGGGTATACACCAAAGT
CTCCGCCTTTGTGCCCTGGATTAAGAAAGTTATTGGCCAG
TAGAAAATTATGGTGAACAAAATAGTATTCTGACTTTGTG
GGCATAAACAATGAAGCACATTTTAGATAATATTTTGAAA
ACTATTTCTTAACACTAGCTGAAATTACCTTTTAAACAAG
TCTTAAATGCCAGAGAGAAAGGCTACGCTTTGCTTTAAAG
GGGCTATATGTACGCATTTTCATGTATTTTATTGCCATTG
TGAGGTTTATGAAAGGTTGTAGACTGATACTGTAGTTGTG
AAGGACACAAAAGGATATGGTGTTTACAAACGCTCCTGAG
AGCCTCTCTTTTCTTCTTTGGCACATGAACGAGTGCTATA
AAAATGCTTAAGATCATGCTGAAAGAGCCGTACTGTAATG
TCAATGTGTCAAACGAAGAAAGGAGATTCATTTAAATCAC
ATCTTGTGGATGTTTAGTCTGTAGTAGGGATGTACGATGT
TGATTAATTAATTTAATTAACGTTAAAAGTAAACCTTTGT
GACTAGTCTAACAAACCCACAGACTGTTGAAAAACAGTAT
TTATGGTATATAGACTCACTGAACACTTTATTAAGTAGCT
ACACCTTACTATACCAGGTTGGACCCACTTTTGCCTTCAG
AACTGCCTTAATCCTTTGTGGCAAAGATTTCACAAGGGAC
TGGAAAATTCCTCAGAGATTTTGGTCTTTATTGAGATGAT
AGCATCACATAGTGAGTTCTATGATGCGAATCTCCTGTTC
CACCACATCCCAAAGTTGCTCTATTGGATTGAGACCTGGT
GACTGTGGAGGCCATTTAAATACAGTGAACTCATTGTCAT
GTTCAAGAAACCAATCTGAGATGATTTGTGCTTTATGACA
TGATGCATTATCCTGCTGGAAGTAACTATAAGAAGATAGG
TACAGTGGTCATAAAGGGATGGACCAGGCAACATTTTTCC
AATCTTCTATTGTCCAACTTCGGTGAGTCTGTGAGAATTG
TAGCCTCAGTTTCCTGTTCTTAACTGACAAGAGTGGCACC
TGGTGTGGTCTTCTGCTGGTTCTGGTTCTGTCAACAAGGC
GTTTGTTGCTGGGTTCTCGAGATATACCGGAGCTCAAACT
TCCCTTTCGCCCTGCAAACGGGAGGGAGCCCCGGGCTTGA
GGATCTCATTGGCTCAGGGCTCTCTCCCGGGACAGCATGC
CAAACTAGCTTATTACCAATCATCAGCCAAGTGTGAACTC
TTGCAATTGGCCTTAGTGTATGTGTGTGTGAATGAGAGTG
TAAGGGTGTTTCCCAGTACTGGGTTGCAGCTGGAAGGGCA
TCTGCTGTGTAAAACGTATGCTTGATAAGTTGGTGGTACA
TTCCACTGTGGTGACCCCTGATAAATAAAGGGACTAAGCC
GAAGGAAAAAGAATGAAATGAATGAATATTGCCGCTCGCT
TGAAACGGATATTGCATATACTTTTTTTAGATATTGTGCA
GCTCTACTAGGCAGTCTAGTACCAAAAATTACAAGCTTTA
ATAGAATTTGTGAACTAAAAGTAAATTGAAATACTGTAGT
ATATTGTATTTGGGGTGCTTTGTTACATTCAGTCTCCTGT
TTCTCGTGTGCAGTATGAGCTAGCAGTGGTTTCTGAAATC
TACATATAGCCCTTTTAAGTGTGGGGTGATGAAGGGATGA
AGTCAAAAACCAGAAAAATGATTTACAGTCAGTGGGTAAA
ATGTGTTCTGTGATAATTGTATTTCAACATATTTCCCATA
ACCAGGCTTCCATAATATATATTTGCTATAATTTCAACTA
GTGGGCACTGAACTGAAAATGTAGGTTGCAGAAAGCTTCC
TTGCACAACCTACAAGTTTTTGGCTGTTTTTGTACAAGGA
CATTTAAAATATTTTTTTTAAAGAATGATTAGCTTTAGTA
GAGTTGGATTTTAAATTGGGAATAAATCTAAACACACTGA
ATAAAGTCAGTATTTGTGGGTTTAAAAATTCATGACAAAA
TGCATAGAGTTGTCTTAAACTTTCCTTTTTTTATGAAAGC
ACTTCAAGGGTTGAAGAGACCACATTGGTGATTGTGGAAT
TATTCTGATTTCTTTTTTTAATGAACATGTATCCAAGTGA
CTGTATTCTTCTTACCATTAAGAAATAAGCACAAACTTTA
AACCATAAACCAGGATGTGTAATGTTTCTCAGTTGATACC
TATTTGAGCGTCTTGAAGAACGTTCCGATGGCTTGAAATC
ACATCAGGCTTTAATGCTGAAATGAGAAGATTCTGGATTT
CCTGCCAAGAAATCTATGGTAATTCTAAACTCTTGGGAAA
CGGTTACCATGCCATTGCTTAGAAACGGACCGCATCACCT
CATCAACACATTAGATGACATCATAATCCATCCATGACTT
CATTTGTTATAGATCAGATGACGGTGACGATAACTGGACT
GAGGCTTGCTGTCTTAACATGAGGCCATTTTACATGCATA
CATACACTCACCGGCCACTATATTAAGTACACCGTACAAG
TACTGAGTTGGATCCCCTTTTGCCTACAGGACTTCCATAA
TCCTTTGTGGCATAGTTTTAATAAGGTACTGGAAATATTC
TTTGGAGATTTTTTGTCCACATTGACATGATAGCATCACA
AAGTTGCTGAATCTCCATGATGCGAATCTCCCGTCCAGTA
CATCCTAAAGGTGCTCTATTGGATTGAGATCTGGTGACTG
TGGAGGCTGTTTGAGAACAGTGAACTCATTGTCATGTTCA
AGAAACCAGTTGCCGCCAAATTCTGACCCTACCTCCGGAA
TGTCGCAGGAGAAATCAAGACTCAGCAGATCAGGCAACCA
TCACCTCAAAATCACCTTTCTTCCCCATTCTGATGCTCAG
TTTCAACTGCAGCAGATCATCTTGACCCTGTCTACATGCC
TAAATGCATTGAGTTGCTGCCATATGATTGGCTGTTTAGA
AATTTGCGTTAACAAGCAGTTGGACAGGTGTACCTAAAAA
AGTGGCTAGTGAGTGTACATCCGCCTAATATTTTTGCAGT
CACACTCTCTTCCAGAAGGAAATGGGAATTATGTGCAATG
GCAGACTCTTTAAACAACTTTGTTTTATGACTGTGTTAAT
TAGAGCGCTTTATGTTAGCATAATAAATGGTCTTCAATTT
ATGTTTTCTGTGATCTGTGTCTATAATAAACCATCATAAG
CATGATTTATGAGCGTAGAGACTAGTACGGCCTTTTTATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations