Transcript

si:ch211-129c21.1-202

ID
ZDB-TSCRIPT-090929-2151
Name
si:ch211-129c21.1-202
Previous Names
  • si:ch211-129c21.1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000012176 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000012176|OTTDARG00000010557|ZDB-GENE-030131-5796 si:ch211-129c21.1|OTTDARP00000010477 CH211-129C21.1-002 LG_ BX005201.7 Danio rerio protein_coding NOVEL, 760 bp
CTGGAACTACCGGTTGTAGATTTGTCTTTCCGAAATGATT
GTATGTCACTTTAGAGATATTAACGCTGAGTGGATGGTGA
TTAGCGTTAATGTTTGTGATGGCAGCAATGTGTCATGGTG
AGGGTCATTCGATGACCTATGACTGATATCATCTCCTGCT
TTAGATTTTTATTTGCCGTCCTTCAGCCTCCAGCATCATG
GATGTCCACCTTTTCCCACCAAAATACTCAAGCAGTAAAC
ATGTAAATTGGATACGGACGCCTACATAACCCAGCCTGCT
GCAGAACATGACTTATAAGCTCATTTTCTTTACTGAAGTA
CACATTTGTTTGTAGTTTCTTTTTTTTGGCTCAGTGAGGA
ACAGAGCCATGTCTTCTCTGTTGTTTTTCATTGTTCATCA
TGGCGTATTGGCATTTGTCTTTGCTGGATCGAGCAGTCTG
GATATTATTGCTCGAAAAACCATTCAGTATGAAGATAACC
ATGCGATCACATTCAAAGAGCAAGGCATCTGGAATTACTC
CACCATGCTGATCAGGGAGGATCTGGGTTTGCTGGTTTTG
GGGGCGAGAGAAGCCGTTTTCGCTCTTGACATCAATGACA
TCTCCGTCTCCAGGTGCTTTGGAAAGTCACTGAGGAGAAA
CAAAAGGAGTGCACCTCTAAAGGAAAACATCCTGACATCG
ACTGTCATAACTATATACGGATGCTGCATCAGATGAATGA
CAGTGTGATGTACATTTGTGGAACAAACGCCTTTAGCCCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations