Transcript

si:ch211-129c21.1-201

ID
ZDB-TSCRIPT-090929-2150
Name
si:ch211-129c21.1-201
Previous Names
  • si:ch211-129c21.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000012175 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000012175|OTTDARG00000010557|ZDB-GENE-030131-5796 si:ch211-129c21.1|OTTDARP00000010476 CH211-129C21.1-001 LG_ BX005201.7 Danio rerio protein_coding NOVEL, 2398 bp
ATGAGACACGCTGACAGAAAACAGTTCTACGAGAGACATT
TGCTCAAGTGCGTCTCCGATAACCATGCGATCACATTCAA
AGAGCAAGGCATCTGGAATTACTCCACCATGCTGATCAGG
GAGGATCTGGGTTTGCTGGTTTTGGGGGCGAGAGAAGCCG
TTTTCGCTCTTGACATCAATGACATCTCCGTCTCCAGGTC
CAAGGTGCTTTGGAAAGTCACTGAGGAGAAACAAAAGGAG
TGCACCTCTAAAGGAAAACATCCTGACATCGACTGTCATA
ACTATATACGGATGCTGCATCAGATGAATGACAGTGTGAT
GTACATTTGTGGAACAAACGCCTTTAGCCCCACCTGTGAT
TATATAACGTATGATAATGGGCAGCTGCAGCTGGAGGGAA
AACAGGAGGACGGGAGGGGGAAATGCCCTTTTGATCCCTT
CCAGAGGTCCTCTTCCGTCATGGTTGATCAAGACCTGTAT
TCTGCCACCTCCTTAAACTTTCTGGGTTCAGAGCCGGTCA
TACTTCGTACGTCTCCCATTACATTGCGGACATTGTTAAA
GAGCTCTTGGCTCAATGAGCCAAACTTCATCTACATGGAT
GCGGTCCCGGAAAGTGAGGACAGTCCTGAAGGTGACGATG
ACAAGATTTACATGTTCTTCAGTGAAAACGCCATCGAGTA
CGACTTTTACAACAAGCTCGTCGTGTCACGTGTGGCCAGA
GTCTGCAAGGGTGATATGGGAGGTCTGCGGACCCTCCAGA
GGAAATGGACCTCATTCTTGAAGGCTCGTCTGGACTGCTC
AGTCCCTGAACCCAGCCTGCCCTACGTCATACAGGACGTC
TTCCATGTCCGCCACCAGAAATGGAGGAAAAGTGTCTTTT
ATGCTATATTCACCTCTCAGTCAAGCTCAACGGATCAGTC
GTCAGCTGTATGTGCATATAATGTGACTGATATCAGCAAC
GTGTTCTCACGTGGCAAATTTAAGACAGAGGTGGCGGTGG
AAATGTCTGATGTTAAGTGGGTGACATACAGCGGAGACCT
TCCTGTTCCTCGGCCAGGAGATTGTATCAACAACGCAGCG
AGGACTTCAGGAATAAAAAGTTCGATGAATATCCCTGATA
AAACCCTCCAGTTCATCCGAGACCGTCCTCTAATGGATGA
TGCCGTTCATCCAATTACAGGAAAACCACTGCTGCTCAAA
AGAGGGCCCCTGTTGACGCGTCTCGTTGTAGATATGGTAA
CGGCAGCAGACGGACAGTCCTATCCCATGATGTTTGTGGG
CACAGCAAACGGTTATGTGCAGAAAGCAGTGAATTATGAT
GGAGAAATGCACATCATTGAAGAGGTCAAACTGTTTGAGA
GTGAAGAGGCTATTGACGTCCTCCGACTTCATCAGAATCA
GTTGTATGCAGGCTCTGCATCCGGGGTCGTCCAGATGCCT
GTCAGCAACTGCAGTCGCTATTCTTCCTGTCTGGACTGTG
TGCTGGCCAGAGACCCATACTGTGCCTGGGACGTCCCAGC
TCAACGCTGTTCTAGATTTCCCGCATCAACTGAGCATGCA
AAAAGTAACCTGATACAAAGTCTTAAAGATGGAGATGCCA
CTCAGTGCCCAATAACAGCTCCCATTGAACCAAAGGTCCG
TACGCTGGTACTGGGAAACAACATCAGGCTGCTGTGCCGA
CCAGACTCCAACCTGGCCCAAGTGAACTGGAATTTAGCTG
GAAAGCCACTGCCTTTCTCAAACAGGAAGTATACCATTTA
TAATGATGCAATCCTTATCTCTAACGCCTCCTCCGCTGAC
GCTGGACGTTACACATGCGTGTCAGTGGAGCAGGCGAAAG
GGAAACACTACACCAAAACACTGGCCATTTATGACTTGCA
TGAAGAAGTAGCAGTCGTTGTGACAGATAAGATTAAGACC
ACGTTGGGAATACCTAATGAAATCTACACAACGTCATCAG
GTTTGATTAAACCTGAAGAACCGCCGTCGTTTTCTAAAAA
TCAGGCCAGTGACAGTAAATGGATAGCGATGCAAGTGGCG
CTGGCGATGCTGTCCATTATGATGGCGTGCCTGCTGATCT
GGAACTTGTACATGGGCCACATCTCTCCATTCATGTGTTG
TGGGAGGCAACCAATCAAAAGCCATGGGAATCTTCCAAGA
ATGGAATATAAGTCTGCGGGAAATGATGTCATGGACAGTA
AACCTCAAATGGTCAACTTGTGTGTCACAACGAACAGTAA
TCTAGAAGTGACTGGCTTCCACAGGAATGGGGATCCCTCA
ACGGGCATTCATTTGTTTAAGTATATCACTGATGAGTCTG
AGATTTGATGTTCTTTTACTAAATCATTTTGTATAATTTT
TATATTTATTTATTTTTTTATTAATACTAATAAAAAGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations