header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-21069
Transcript Name: atp1a1a.1-004
Previous Name: atp1a1-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040977 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040977|OTTDARG00000029782|ZDB-GENE-001212-1 atp1a1a.1|no_translation atp1a1-004 LG_ CU185242.13 Danio rerio protein_coding KNOWN, 313 bp
AGGTACTGCCAGAGGAATTGTCATCAACACTGGTGACCGC
ACAGTCATGGGTCGCATCGCCACTCTCGCTTCTGGCCTTG
AAGTTGGTCGCACCCCCATCTCTATTGAGATCGAGCACTT
CATCCACATCATCACTGGTGTAGCTGTCTTCCTGGGTGTG
TCCTTCTTCATCCTCTCCCTCATCCTTGGGTACAGTTGGT
TGGAGGCTGTCATCTTCCTGATTGGTATCATTGTTGCGAA
TGTACCAGAGGGTCTCTTGGCTACTGTAACTGTGTGTCTG
ACTCTCACTGCCAAACGAATGGCAAAGAAGAAC

atp1a1a.1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA atp1a1a.1-002 (1) 867
atp1a1a.1-003 (1) 416
atp1a1a.1-004 313
atp1a1a.1-005 (1) 652
atp1a1a.1-006 (1) 772
mRNA atp1a1a.1-201 (1) 3506
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
atp1a1a.1-004 Contained in:
OTHER atp1a1a.1-004 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000040977 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CD602979 (1) 330bp
    GenBank:CD602920 (1) 316bp
    CITATIONS (1)