Transcript

nrf1-201

ID
ZDB-TSCRIPT-090929-209
Name
nrf1-201
Previous Names
  • nrf1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002435 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002435|OTTDARG00000002253|ZDB-GENE-001221-1 nrf1|OTTDARP00000002159 nrf1-001 LG_ AL590150.2 Danio rerio protein_coding KNOWN, 2933 bp
GCTCCGCCGCACCGCGCAGGCCCGAAGTAGCGCAGCCGCT
CTGAGTGTGTTTGAGTGAAACTGTATCGGGTGATGGAAGA
CCATACGGTGCATCAGACGGAGCATATGACCACTATCGAG
GCCCACGCCGTCTCTCAGCAGGTCGGGCAGGTGCACGTCG
CCACATACACAGAGCATGGCATGCTGAGCGCCGACGAGGA
TTCGCCCTCCTCGCCTGACGATGATGCTTATGATGACTCC
GACATCCTCAATTCAACTGGAACAGATGAAGTCACCGCAC
ATCTGGCTGCTGCTGGGCCTGTTGGCATGGCAGCAGCTGC
CGCTGTGGCAACAGGAAAGAAGCGTAAAAGGCCTCACATC
TTTGAATCAAATCCTTCAATCCGTAAAAGACAACAGACGC
GCCTGCTTAGGAAGCTGAGAGCAACTCTAGACGAATACAC
AACACGGGTAGGCCAGCAGGCTATTGTTTTATGCATATCT
CCCTCTAAACCAAATCCTGTGTTTAGAGTATTTGGAGCGG
CACCACTGGAGAATGTGGTGAGGAAATACAAGAGCATGAT
TCTGGAGGATCTGGAAAACGCTCTGGCTGAACACGCACCC
CCTGGTGGAGGAGAACTCAGCTCTGAACTTCCTCCGCTGA
CTATTGATGGGATACCAGTGTCTGTGGACAAGATGACACA
GGCCCAGCTCCGAGCGTTCATTCCAGAAATGCTGAAGTAT
TCCACAGGCCGAGGGAAGCCCGGCTGGGGGAAAGAGAGTT
GCAAGCCCATCTGGTGGCCAGAGGACATTCCCTGGGCCAA
CGTGCGCAGTGACGTCCGAACAGAGGAGCAGAAACAGAGG
GTGTCATGGACGCAGGCCCTGAGGACTATCGTTAAAAACT
GCTATAAGCAGCATGGGAGAGAAGACCTGCTCTATGCCTT
TGAGGACCAGGTCACCACACAAGTTGCCACAACAGCCACA
CACAGCATTGCGCACCTGGTGCCGTCACAGACGGTAGTGC
AGACGATCAGTAATCCTGATGGAACAGTCTCACTTATACA
GGTTGGCACTGGAGCTACAGTAGCGACACTGGCAGATGCG
TCAGAATTGCCTGGCACAGTGACAGTAGCCCAGGTGAACT
ACTCCACAGTGACGGATGGAGAGGTGGAGCAGAATTGGGC
CACACTTCAGGGAGGCGAGATGACCATCCAAACCACACAA
GCGTCAGAGGCCACGCAGGCTGTGGCCTCTTTAGCCGAAG
CTGCAGTTGCAGCTTCGCAAGAGATGCAAACCGGGGCAAC
TGTAACCATGGCCCTCAACAGTGAAGCAGCAGCTCACGCA
GTAGCGACATTAGCAGAAGCGACTCTTCAAGGCGGAGGAC
AGATCGTGTTAGCAGGAGAAACGGCTGCTGCAGTCGGAGC
GTTAACTGGAGTTCCGGATGGCAGTGGTCTCGTCCAAATT
CCAGTCAGCATGTATCAGACTGTGGTCACCAGTTTGGCCC
AGGGCAATCGGCCCGTTCAGGTGGCAATGGCTCCCGTAAC
GACTCGAATCGACAACACGATGACTCTTGACGGGCAGGCG
GTGGAAGTGGTGACCCTGGAACAGTGACATACTCTACCCC
TGCAGGTGTGCGGGACAGGAACTTCAGCGCCTATGTGAAG
TAGCTGCTGGAATATGGTGTAAAGAATAATATTTGAGCCT
GTTCTCATGTCTGCAGGGGTGTGTAGGGGTTGTCTCGTTA
TTGTTATTCATTTTCATTTTGTTTGTTTTTTTACGCTGTA
CCCCCAATTTGTTGTCTTATTTTCATCATAGTGTTAAATT
CATTAACGTTAGTTTCGTTTCTCTTTTTTTTTTTTAGCTG
GTGTTTGACAAATGTAATGCAGAGGATACTTAGAATTACC
AATTATTTCTTTCTGTACGATTACAAGAAAAGAAAAACCT
CAGTCCAAATTTTCTGCCTTCAAAACTGGCGCAATTTGTT
CATTTCTCCCCCGTGTATATGGCATTATGTTGGTCATTCT
TAATGCGTTTTCTCCTCAGTTTTTATGTACATATTATATA
TATTGTGAACCATCTTGTGCCATATTTGAATAATTTCATT
AATATATTGTGTATATTGCATTACAATTTTAGTGTTAGAT
CCCATTGACTACTGAGATATGCATGGTTTTTTTTTTTTTT
TTTGTAAGTCTGTACAATGTAGTTTTCTTTGTATGCATTT
CACATAATTCCCATTGTAAAAAAAAAAATTGTATGATCTC
GAATGATGTGGTATATCGAATGAGACCACCGTTTCCTGCC
GGTACAGATTTGAACTTTCAGAACTCTCAGTGCTATCTAT
AGACTATTCACTAAATTGTACTATTAATCGATTGCTATAA
ATGTCAGTATGACAAGGATGAAGATGTAGCACTCCATATC
GTTCAGCTTTTATACTTCAGAAAACAGAGAGCTTTACATA
TTCATGGTATGTCCGCATTTTGGAAACTGATCCTGTTATG
AAACTGCTAGGGAAAATGTTTTATTTATTTTTTATTTATT
TTGGTTTGTTTAGATGTGCGCTCATATCTTTTGAATAAGA
CACATGGGAAAAGGTTTAGATATGATGTAGGATGTATTCG
AATTCTAATGTTATCGCAAAGTGAAATACCCATAAATTCA
TATCTCTTTCTTTATCTCCCAAGCTCTTGTATTGTTTCTA
CAGTGCAATTTTGGATGTTTTGTTACTGTTTCTTCCACCC
GTGATCCACTCTGTCGAGTTTCCAGCTCCTTCATCGGTTC
GAATTTTTATAGCTCACACAAATGAGAGGCTTTTTATGTG
AAATTTGTAAAATATATACGGTTTGATGAAACCAAACCCT
CCCGTGTTGCTGGTGCAAAATGATGGTGACATTGGCAAAC
TTTGTCTTTCCCTTTTTATCCAGTCTTGGAAATAAAATGG
CCACTATTCAGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations