Transcript

dkk1a-201

ID
ZDB-TSCRIPT-090929-20658
Name
dkk1a-201
Previous Names
  • dkk1a-001
  • si:dkeyp-86d6.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040529 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040529|OTTDARG00000029524|ZDB-GENE-090313-406 dkk1a|OTTDARP00000032384 DKEYP-86D6.1-001 LG_ BX324172.22 Danio rerio protein_coding NOVEL, 1286 bp
CGCGTGACACACTGGCAGAGGAGATCATGAGGAACATGCT
GTCACTGCTCGCCGTTTTGACTGTGTATCTCGCGGTTTGG
GGAGGAATCACAGTGGATGCTCAAGTTGGATCTGTGTTAC
GGAACTCCATCAGGCATCTGCCCGCTGCATCCAGCCCGAG
TGACGCGGTGAGCGCGAGCCCGCGGGTCACCGGCACCGTA
GACAGCGACGCTCCGCCGTCTCCGCACTGCTCCGCTGACT
CGGAGTGCAGCATCGGTGAGTTTTGTAACGGCTCGCGTGG
AGTTTGTCTGTCGTGCCGCAAGCGGAGGAAGCGCTGCGCT
CGTGACGGAATGTGCTGCGCTGGAAACCGATGCATCAACG
GTGTGTGTCAGCTTGCTGATGCAGCTGCTGTCGGGTCTGC
TGACGCCAGTCCACCGGGTGGCAACACAGATGTGTCTGGT
GTGGCTGTAACACGTGGGCAGAACTTCACACATCCCAGGA
GAACCACAGTCCTGTCAAAACCACAGCAGACACAGAAAGG
AGGCGAGGGTGAGACGTGTCTGAGGTCTTCAGACTGTCTG
GAAGGGCTCTGCTGCGCTCGACACTTCTGGTCACGGATCT
GTAAGCCGGTGCTGACAGAGGGACAAGTTTGCACGCGCCA
CCGGAGGAAAGGAGCTCACGGTCTGGAGATCTTCCAGCGC
TGCGACTGCGGCTCCGGCCTGACCTGCAGAGGCCAGAGAG
AAAAACCCGGAGCGGAAAGCCGAAACCTCCACACCTGCCA
ACCGCGCTGACCCTGCAGACTCGCTTTGTGCTCAACACAC
ACACATACAGACACAACACGCATGCAGACACACATGCAGC
AAAGGAAAACTGATTCCACGGAAGGATGCGCCATTGAAAG
GACTGATCGTATTTCCCGGACGGATGCAGAGAAACTGCAC
CGTACGGATGTTTCTTGTTGTACACTCTGCTATTTAAGAC
TTTTTTCCCCGGGTCATCACAAAAGGCAGAATGCTTTTGT
TTCCCTTTATAAGGAACTTCTTATTCTTCTTGCAGTAAAT
TACTGTATTGTAAATACGTAGTCAAAAATTGCACTTAACA
CTGAGCATATGGATCCTGTAAACGTAGCATTTCATGATTC
AAACACATCAATATTGTAAATGTGCAAGCCATATGATTTA
GATGGTTATCAGTACTCGATTTTTATTTCGAACATATTGT
AAAAATATTTGTGTGGTTCAAATATATATATATATATATA
AGTGAAATGACTATAACAACAATAAATGGATTTTTACGAT
TCATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations