Transcript

oprk1-201

ID
ZDB-TSCRIPT-090929-2045
Name
oprk1-201
Previous Names
  • oprk1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000011686 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000011686|OTTDARG00000010171|ZDB-GENE-030729-1 oprk1|OTTDARP00000010081 oprk1-001 LG_ AL929096.5 Danio rerio protein_coding KNOWN, 1486 bp
TAAGGTGGCAGTCAGTCATCAATTGAATAGGAGCGGGCCA
AAGAAATCCACGCATTGCGCACAGGCATCACTATTGTTTT
CAAACCTTGGGATTTTCGTCTTAAACTACCTGTTTAAAAT
TCACAACAAGACGATGGACAGCAACGTGGTGCAGATTTTT
AAGGAGGATAAATGCCCCTCATCTCACCCTGAGAAGTGTT
TACCTAACTTCACATGGCAATCTGCCGTCTCGGACATTTA
TAACAGTTCTCTGAATGAAAGCTGGACGACCGAGCAGGAA
GCTATGTCCCCTCTCATTCCGATCATCACTGCCGTTTACT
CCGTGGTGTTTGTTGTTGGACTGGTGGGAAACTGCCTGGT
GATGTATGTCATTATCAGATACACCAAAATGAAAACCGCC
ACCAACATCTACATTTTCAACCTGGCTGTCGCAGACGCTT
TGGTAACCACCACCATGCCCTTTCAGAGCACAGATTACCT
GCTGAACTCTTGGCCATTTGGAGAGGTGGTTTGTAAAGTT
TTTATCTCCATCGACTACTACAACATGTTCACCAGTATCT
TCACTTTAACCATGATGAGTGTGGACCGATATGTGGCCGT
CTGCCATCCCGTCAAGGCCCTGGACTTCCGGACACCAATG
AAGGCTAAGATCATCAACATCCTCATCTGGGTGCTGTCCT
CGGCTGCTGGGATCCCTGCAATGGTTCTTGGAAGCACTCA
GACGAACAATGGCACGACAGAGTGTGCTCTGCAGTTTCCA
GACCCGTATGTCTACTGGGACACATTGATGAAGATCTGCG
TCTTCATCTTTGGCTTCGTGGCTCCTCTTCTCATCATCAC
CGTTTGCTACACTCTCATGGTTCTGCGCCTCAAGAGCGTT
CGCCTGCTTTCAGGTTCACGTGAAAAAGATCGCAACTTGA
GACGCATCACTCGATTGGTTCTGGTTGTGGTGGCAGTGTT
CGTTGTGTGCTGGACCCCCATTCACATCTTCATCCTGGTC
AAAGCTCTTTCGCACGGTGTGCCGGAGACCACATCGGTCA
TGGCTGCCTACTTTTTCTGTGTGGCGTTGGGGTACACCAA
CAGCAGCCTGAACCCCATTCTGTACGCCTTCCTTGATGAG
AACTTCAAGCGCTGCTTTAGGGACTTCTGCTGCCCAGGTC
GGACTGCAGGCGACGGGCGTGGGGTTAGTCGGGTCAGAAG
CACTCTCCGAGAGCACACGTGCCCAGCAGAGGCCAAAAAT
GATGGAGGCCAGGGTCGACCCGTATGACTAGCCGTGGAGC
TGTCATCTTTTCATGGTCGAGAGGACTCCAATGACTTGGG
ACTGACACAGATCACAACCGCCATCTGAGGAAGGGATTGT
GGCGTTTAGGTTCAGGCGAGGGCGCTTAGGAATCTGTGAT
TGAGCAAAAAGGCTTTGTTCATTCAGTATGTCCATATAAA
TATTTACGGCATCACCTCATTTAGAGTTTACTTTCTCATC
CCCGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations