Transcript

ptk2aa-203

ID
ZDB-TSCRIPT-090929-20363
Name
ptk2aa-203
Previous Names
  • ptk2.2-001
  • ptk2aa-001
  • ottdart00000040187
  • si:ch1073-355e8.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040187 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040187|OTTDARG00000029312|ZDB-GENE-031114-5 ptk2aa|OTTDARP00000037724 ptk2.2-001 LG_ CU424444.7 Danio rerio protein_coding KNOWN, 1150 bp
AAGCCGGAGTCCAGGAACTCTCGCAGCAGCATCGACCGTG
AGGACGCCGCTCTGCAGACCCCGATGGGAAAGCAGCACGT
TTACCAGCCCGTGGGCAAAACCGATCTTGTGGCTCCTCCA
AAGAAACCTCCTCGTCCCGGAGCTCCAGCTCACCTGACTA
ACCTGAGCCCGGCCGACAGCTATAATGAGGGCGTCAAGCC
CTGGAGGCTTCAGCCTCAGGAGATCAGTCCTCCTCCGACA
GCCAATCTGGACCGCTCGAATGATAAAGTGTATGAGAATG
TGACGGGGCTGGTGAAGGCCGTGATCGAGATGTCCAGCCG
CATTCAGCCCGCGCTGCCAGAGGAGTACGTGCCCATGGTC
AAGGATGTTGGTCTGGCTCTCAGGACTCTGCTGGCGACGG
TGGACGAGACTATACCAGTGTTACCAGCACACACACATCG
AGAGATTGAGATGGCGCAGAAGCTGCTGAACTCTGACCTG
GCGGAGTTGATCAGTAAGATGCGTCTGGCGCAGCAGTACA
TGCTGACCAGCCTCCAGCAGGACTACAAGAAGCAGATGCT
GACGGCGGCTCACGCGCTCGCTGTGGATGCCAAAAACCTG
CTGGACGTCATCGACCAGGCCCGACTCAAGATGAGCCACC
GCACACACTGAGACCTCCACACTGGCTGGATCATCACGGA
GGAACATCACTCTTAAAGAGACACACTTCACCCAAACATC
TGATCAGTATTAATGAGTTGAAGAATGCTGGAAACTGGCT
GCCATTAGCTGTTTCTATCCAAAGATGAGAAGTAGATGCA
TGCGCAAAACTGCAATATTGCATAAAACAAGCGAATATAG
CAGAAAAAGAGAGCTGGATCATCACTTCCTGATCAACATG
CTCAAATATCTGTCAGAGGAGTTAGTTTGATGCGTTGGTA
TTCGCCACTGTGGTGTTTCTTCTCTAATAAATAAGTTGCA
CCTCAGAAACGCAATGAATGCGGTGGCTTTTGGAGGCGTG
AGATGGGAGCACAGACAGATGCTGGAGGGAAGAATAATAA
TACTGAAGCACTGTGATGACGGAGGGCTGAGGTAGAGATC
TGCGCGGGACTAAATTTTGAATCCCGCTCCCGCCCGCCAA
GTTTTAGCCCGAACCCGACCGCTCCCCGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations