Transcript

npas2-201

ID
ZDB-TSCRIPT-090929-20175
Name
npas2-201
Previous Names
  • npas2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039934 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039934|OTTDARG00000029152|ZDB-GENE-030408-3 npas2|OTTDARP00000031924 npas2-001 LG_ CU464080.7 Danio rerio protein_coding KNOWN, 2683 bp
GGAGAAGACGCGAATGGGACACGCCAGCCTTCGCAGACAG
CCTGAATGGGAGAAGGAGTGAGCATGGACAACCTTTCGGA
GTTTGGAGGCCTTTGTCCGTCCAGCCGGAGGGAATGGGAC
ACAAGCAGTTGTGTGGATGATTTAATGGACGAAGATGAGA
AGGACAGAGCAAAAAGGGCGTCCCGGAACAAATCGGAGAA
GAAGAGGCGAGACCAGTTCAATGTTCTCATTAAGGAGCTG
TGTACAATGCTGCAGGGTCAAGGTCACCCCCGCAAGATGG
ACAAATCCACCATCCTGCAGAGGACCATCGACTTCCTGCA
AAAACAGAAAGAGATCACGGCACAAACAGAGTCTTGTGAG
GTCCGGCAGGACTGGAAGCCTTCTTTCCTCAGCAACGAGG
AGTTCACCCAGTTAATGCTGGAGGCGTTGGATGGTTTTCT
AATAGCTCTTACCACAGATGGGAACATCATATATGTATCT
GACAGCGTCTCGTCTCTCATTGGCCATCTGCCGTCAGATA
TGGTGGACCAGAACATCCTGAACTTCCTGCCAGAGCGAGA
GCACGCAGATGTGTATAAACTCCTGTCTTCACACATGCTT
CTGACTGAGTCTTCTACTGTAGACCTGCTCAACAGCAATG
AGACACACGTCGAGTTCTGCTGTCATATAGCGAGGGGAAA
CATTGACCCGAAAGAACCGCCTACGTACGAATATGTCAAA
TTTGTTGGAGATTTCAAGTTTCATAATAATGTGCCTCTGT
CTTCATGTAATGGTTATGATCTGGCGTTTCCTCGCACGCT
GCAGTCCTCAATAGAGGAGCAGGTCTGCCTCGTGGCCACA
GTCAGACTCGCAACCCCTCAGTTCCTCAAGGATCTTTGCA
ACGTGGAGGATGTGTGTGATGAATTCACATCAAGACACAG
TCTGGAATGGAAATTTCTCTTCTTAGATCACAGGGCCTCT
CCTATCATCGGGTACCTGCCGTTTGAGGTTTTGGGGACCT
CGGGTTATGATTACTACCATGTGGACGACCTGGAGCTGAT
TGCTCAATGTCATAAACAATTGATGCAGTGTGGGAAAGGA
AAGTCTTGTTACTATCGGTTCCTGACTAAAGGACAGCAGT
GGATCTGGCTGCAGACGCACTATTACATCACGTACCACCA
GTGGAACTCCAAACCTGAGTTCATCGTCTGCACACACAGC
GTGGTCAGTTATGCTGAAGTTCGAGCGGAGAGAAGGAGAG
AGTTTGGATTGGAGGAGAGCTCATCTGATATGGCCACATC
CTCAATCAAAGGCCAGGAGGTGTTTTTGGACATGTGTCCT
CCTCTGGAAGCTACACGGGACAGAATCAACAGCGCTCGAT
CAGTGTCATCACAGAGCTCCAGAAAATCATCACACACAGC
GCTCTCCGACTCCGCATCGAACTCCTCAGTGAGATACACA
GAAGCATGTACGTCATCCCGGCAGTCTGCTTCCATCGGCC
CTGAGAAGAGCTCCAACAGAATGACACACACTGGAACAAA
GACCCTGATTCAGAGACAGAGCTCTTCAGAGCCCCCGTCA
CTCTCTCCGTCCTGCAGTCAGCATTCAGCCATGACTCAGT
CCCTGTACAGCTTCCAGCAGCCTCAGTTAGGTGTCATGCA
TCAGCTAAAGGAGCAGCTGGAGGAGCGAACGCGGATCCTA
CAGGCCGACATCAAAACACAACAGCAAGAGCTGCACGACA
TTAAAGAGAAGCTGCAGCTCGCCAACCTACAGATGTTACT
CCAGCAGCCGATACAGGGAGAGTTTGCTGGTTCTGGTCCA
CAGCAGCAGGGTCCAGGCAGGCCGGCTCAACAAAACACAC
ACCCTAAACCTCAACACTGTGTTTCACATTCATCACACAC
ACTACAACCCAACAGCTCATCCACTCAGGGGCAGCAGAGG
CTGGTTCAGGCTGGACACATGCAGGCCGTCAGTGTTCCAA
TGCAGACACACACCAGTCTGACCACACCCTTCTACAGCAA
CCCCATGATGTTCTCCCCCAACCACGGACACCGAAGCCAA
CATGACACACACTGCCAAAGAAACACACACGCCGACTACA
GCCAGGACGGACAGCTACGGATGCTGCTAAACCAGCCAAT
GCAAACACTTGTACAAGACAGCAATGGGGGGCCCCAGTCT
TCCCAATGCACCTCAACTATTCAACAAACCAAATATCCTC
TGGAGCAGCAGATGATGGCTCCTTCCTTCCCTGTGCAGCA
GGTGAACTGTAACGCTGTGCTAGTCCCCTCCCCCGTCTTC
ACCTCACCAATCATGATCCCCCATAATAGTTTCATCACCC
ATCAGACCACCCCCACCTACACGACTCACCCGCCGGTTGC
CCCACACAGCTTACCACTACAGCAGCCTCAGCAGTTCTTT
CAGATGCAGCCTCAGGGTCTGATTCACGGCACTCCCACTC
AGGCCTTATTCCACACCCCTAGTGTTCCACAGCAAAGCAC
TGTGGGATACGTACAGCCACAACAGCAGCAGCAGCAACAG
CAGCATCATCATCACTCCCAGTCTGGCAACCTGTCGGACT
ACAGAAACATGCTCCCTCGGTAGCCCCGCACCACGGGACA
AGCCAAGAGGCTGCTGGGAAAGCGCGTTGAGCGATTAGCT
CTGAAAGGTATGATGGGAAGGGACTCTCTCGGCTCAGGGG
AAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations