Transcript

cryba2b-003

ID
ZDB-TSCRIPT-090929-20007
Name
cryba2b-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039756 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039756|OTTDARG00000029016|ZDB-GENE-040718-324 cryba2b|no_translation cryba2b-003 LG_ CU468956.14 Danio rerio protein_coding KNOWN, 854 bp
ACATTGATTATACTGGATCTGTCCCACCTCAACAAGCGTG
GTGATCGACAGCAGCCATGAATCCGCAGGAGCAGTTGGAG
CAGAGGGGAAAGTTTCGGATGACTGTGTTCGAGGAGGAGC
ATTTCCAGGGCAAGAGCTGCGAATTCTCCTTCGAGTGCCA
GAACATTCTGGAAAGAGACTTCAGGAAGATCCGCTCCATT
AAGGTGGAGAACGGACCCTGGGTGGGGTACGAGTATCCTG
AGTTCCAGGGCCAGCAGTTTATCCTGGAGAAAGGAGACTA
TCCCTGTTACCAGGCCTGGAGCGGCAACAGCAGCTACAGA
ACAGAGCATATGCTCTCTTTCAGACCCATTAAATGTGCTG
TAAGTTTGCACAGGCAACATTATGTCAAATCTAAATTGAT
CTCAGGGTAATTCATACCAAGAACCGTAATTATCATGGTG
ACTATACAACTGTTAAAGGGAGAGTTTGCCTAAAATCTCC
ACTTGTTCCAAACCTGTTTCTTTCTTCTGCTAAATACAAA
AGTAGATCATTTAAAGAAAGCGGAAAGCCGGTAACCATTG
ACTTCCATAGTATTTTTTTCCTACTATGGATGTTAATGGC
TACTGGATTCCAACATAATTCAAAATATCTTCTTATGTCT
TCAACAGAGAAAAAATATATTCATTAAGAGGTAATATTTG
GGTCCATATGAGCGTGATTAAATTATGCATATATTTAAAT
TTTTGGGTAAACTATGTCCCAATCTGAATCTACTTTTTAA
TTCTGACATAATGTGTCACGGTTTTGGGAATAAATGATCT
ATAGCAGATGTAAAAACAAACAACAAAGCATGCAAAACAT
ACTTTCTGTGTTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations