Community Action Needed: Please respond to the NIH RFI
Transcript

cxcr4b-201

ID
ZDB-TSCRIPT-090929-20000
Name
cxcr4b-201
Previous Names
  • cxcr4b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039749 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039749|OTTDARG00000029013|ZDB-GENE-010614-1 cxcr4b|OTTDARP00000031782 cxcr4b-001 LG_ CU694482.5 Danio rerio protein_coding KNOWN, 1674 bp
GGACTATTTAAATGCTGCTGTGAGAGGAGGGCGGTTGACT
AAAGTGTGGAGACTTATTGCGCCTTTTTGAGCACACCTAT
AAGAACAAAATGGAATTTTACGATAGCATCATTTTAGACA
ACAGCTCTGACTCCGGTTCTGGGGACTATGATGGAGAAGA
ACTTTGCGACCTCTCAGTCAGCAATGACTTCCAGAAGATC
TTCCTCCCTACAGTATACGGGATTATATTTGTCCTAGGAA
TCATTGGCAATGGACTTGTGGTGCTTGTGATGGGCTTCCA
GAAGAAGTCAAAGAACATGACAGACAAATACAGATTGCAC
CTTTCAATCGCAGACCTCCTGTTTGTCCTCACCCTGCCAT
TTTGGGCGGTCGATGCAGTCAGCGGGTGGCATTTTGGGGG
ATTTCTGTGCGTCACAGTCAACATGATCTACACTCTGAAT
TTGTACAGCAGCGTGCTCATCCTGGCCTTTATCAGCCTGG
ACCGCTATCTTGCAGTAGTACGTGCCACAAACAGCCAAAA
CTTAAGGAAATTGCTTGCGGGAAGGGTGATCTACATTGGA
GTTTGGCTTCCAGCGACTTTTTTCACCATTCCTGATCTGG
TGTTTGCAAAAATCCACAATTCGAGCATGGGTACCATCTG
CGAGCTTACTTACCCGCAGGAGGCCAATGTCATTTGGAAA
GCAGTTTTCCGCTTCCAGCACATCATCATTGGCTTTTTGC
TGCCTGGTTTGATCATTTTGACCTGTTACTGTATCATCAT
CTCAAAACTGTCCAAGAACTCCAAGGGTCAGACTCTAAAG
AGGAAGGCACTGAAGACCACCGTCATCCTCATCCTCTGCT
TCTTCATCTGCTGGTTGCCTTACTGTGCCGGCATCCTGGT
GGACGCTTTGACTATGCTGAACGTCATATCTCACAGCTGT
TTCCTGGAACAGGGTCTGGAGAAATGGATCTTCTTTACGG
AGGCGCTGGCATATTTCCACTGCTGTCTCAACCCTATCCT
TTATGCTTTCCTAGGCGTCAGGTTCAGTAAATCTGCCCGT
AACGCTCTGAGCATCAGCAGTAGATCCAGTCACAAGATGC
TGACCAAGAAAAGGGGGCCTATATCATCTGTATCTACTGA
ATCAGAGTCGTCCAGTGCACTGACGAGTTAGTGTGTGCAT
ATAAAAAAAGAAAAAAACTTTTCCACATGGATGATTAAGC
TTATAAAAACAGGACTTTACTACAGTTTTTGTACATTGTA
AAGTATTTTTGTGTTGATCTGATGACTTTTATTTTGTAAG
ACTTTTATTTTGTTTTTATTCAGCTTTAAAACATATTTTA
AAATTTTTTTTTTTTTATGTACATGTTTGTACTTTTATTG
CCAGACCTAAAGGCTGAGCCTTGACAAAGTCTGTATTCTT
GCTGAAGGTCTTATCAGGAATGTTAGCATAGTCTTTTGTT
TGATTCCCAACGCGTAGTGTAAATTATTTGTACATAGTTC
ATTGTTTGCCATTGTGAATGTGTGTATGTGTGCACTTAGC
TTTTCCAACTCAGTTTAGCTTTTTTATATTTATTAAAATG
GTAGCTCACACTGTAAAAACCTTTTTAAATGTTGAGTTTT
GTAATTTAATTGTCACATTTTTGACGCATTTTAACTTCCA
TTTCATAATAAAACCTAAAAATCAACACTTTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations