header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-19899
Transcript Name: myl7-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039635 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039635|OTTDARG00000028941|ZDB-GENE-991019-3 myl7|no_translation myl7-003 LG_ BX248505.9 Danio rerio protein_coding KNOWN, 503 bp
TGATGTCTTTTTGGTTTTTGTTTCAGGTTCAAGAGGCTGC
TAATGACCCAAGCTGATAAATTTACAGCAGAAGAGGTTGA
CCAGGCTTTTGCAGTGGCTCCAATAGACGTGGCTGGAAAT
ATTGATTATAAGTCGCTTTGTTACATTATCACACATGGTG
ATGAAAAAGAGGAATCTTGAAGAAAGGAAAATGTCTCAGT
TTATGTCTGCATATCTGTTCAGTTCAACATTCACATCAGC
AGCTTTTAATATTAAAACATTTGTGTTGCATTTCAACACA
ATACTAATGTCTGTTTTATATACAAAATAAACATTAGATT
ACTTGACTGAGCTTAAGAGAAGACCATGAGAAGAGATAAT
TGTCATCTTATTTATTCTGTCTGTAACTGCTGCCCCCTAC
AGACTGTTAATTGCAATTAATAACTAGACATTTGGTTTAA
GGCCCTTAAATTCCTTGACTATGAGTAGAGCATCATCTCA
AACCTATAATAAACTTCATACTC

myl7 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA myl7-201 (1)    Ensembl 1026
ncRNA myl7-002 (1)    Ensembl 688
myl7-003 503
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
myl7-003 Contained in:
[BAC] CH211-87L2 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000039635 (1),  Ensembl_Trans:ENSDART00000124414 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB897181 (1) 503 bp
CITATIONS (2)