header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-19897
Transcript Name: myl7-201
Previous Name: myl7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039633 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039633|OTTDARG00000028941|ZDB-GENE-991019-3 myl7|OTTDARP00000031689 myl7-001 LG_ BX248505.9 Danio rerio protein_coding KNOWN, 1026 bp
CTTGTGCAGTTATCAGGGCTCCTGTATTTAGGAGGCTCTG
GGTGTCCATGTAGGGGACGAACAGAAACACTGCAGACCTT
TATAGAAGAACAAATGATAAGAGTCCTCATACATAAAGAC
TCCATTAGAAACGTCAGTGACCCAGGAGCCCAGACCAACA
GCAAAGCAGACAGTGAACATGGCTAGTAAAAAAGCCGCGG
CCAAGAGGGGGAAAACTGCTCAAAGAGGCTCTTCCAATGT
CTTCTCCATGTTTGAGCAATCACAAATACAGGAGTTTAAG
GAGGCTTTTGGCTGCATAGATCAGAACCGGGATGGAGTTA
TCAACAAATCTGATCTGAAGGAAACTTATGCACAACTAGG
GAAGCTGAATGTGAGTGATGAAGAGCTGGAGTCCATGCTA
ACAGAAGGAAAAGGGCCCATAAACTTCACTGTCTTCCTCA
CCCTCTTTGGAGAGAAGCTCAATGGCACAGACCCAGAGGA
AACCATCCTTGCTGCTTTTAAATTGTTCGACCCTAATGCC
ACAGGAGTTGTCAATAAAGATGAGTTCAAGAGGCTGCTAA
TGACCCAAGCTGATAAATTTACAGCAGAAGAGGTTGACCA
GGCTTTTGCAGTGGCTCCAATAGACGTGGCTGGAAATATT
GATTATAAGTCGCTTTGTTACATTATCACACATGGTGATG
AAAAAGAGGAATCTTGAAGAAAGGAAAATGTCTCAGTTTA
TGTCTGCATATCTGTTCAGTTCAACATTCACATCAGCAGC
TTTTAATATTAAAACATTTGTGTTGCATTTCAACACAATA
CTAATGTCTGTTTTATATACAAAATAAACATTAGATTACT
TGACTGAGCTTAAGAGAAGACCATGAGAAGAGATAATTGT
CATCTTATTTATTCTGTCTGTAACTGCTGCCCCCTACAGA
CTGTTAATTGCAATTAATAACTAGACATTTGGTTTAAGGC
CCTTAAATTCCTTGACTATGAGTAGAGCATCATCTCAAAC
CTATAATAAACTTCATACTCAGTTGC

myl7 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA myl7-201 1026
ncRNA myl7-002 (1)    Ensembl 688
myl7-003 (1)    Ensembl 503
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
myl7-201 Contained in:
[BAC] CH211-87L2 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000039633 (1),  Ensembl_Trans:ENSDART00000040013 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC076232 (1) 1044 bp
GenBank:AY057074 (1) 906 bp
GenBank:AF425743 (1) 868 bp
GenBank:AF114428 (1) 751 bp
CITATIONS (2)