Community Action Needed: Please respond to the NIH RFI
Transcript

tbx16-201

ID
ZDB-TSCRIPT-090929-19885
Name
tbx16-201
Previous Names
  • tbx16-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039621 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039621|OTTDARG00000028936|ZDB-GENE-990615-5 tbx16|OTTDARP00000031681 tbx16-001 LG_ CU459194.13 Danio rerio protein_coding KNOWN, 4949 bp
ATCTACAGCAGAGGAACTGACCTGCACTGAAGGAGCAGAA
ACACCAGAGCATTGGACTTAACATTGGAATTAATCCAGTT
CTGATGGAGACCTTGCGTTTGAACTGAAACACTTAGATAC
ACCAGATTTAGATTATTTTCTGACATTTTCTTTTAGAGGA
CATCTTTAAAGAAGGCTAAATAATGCAGGCTATCAGAGAC
CTCAAGCACAATTTCAGCCTCCCTCCTCCTCCATCCATGC
CCGGAGCCGGTGATTCCTACCATCAAGGCAACATCCGAAT
GACTCTGGAGGATCCCGAGCTGTGGAGATCCTTCCATGAG
ATCGGCACTGAGATGATCATCACCAAACCTGGCAGAAGGA
TGTTTCCACACTGCAAAATCAGCTTGTCTGGACTGGTGCC
GTATGCAAAGTACATCTTACTGGTGGACATGGTACCAGAA
GACGGTCTGAGATATAAGTGGAATAAGGATAAGTGGGAGG
TTGCAGGTAAAGCTGAGCCCCAGCCGCCCTACAGGACGTA
CCTGCACCCGGATTCACCAGCGCCCGGCAGCCACTGGATG
AAGCAGCCCGTGTCCTTCCTCAAGCTGAAGCTCACCAATA
ACGCACTGGACCAGCATGGACATATTATCCTTCACTCTAT
GCACCGCTACCATCCACGTTTCCACATTGTTCAGGCTGAT
GATCTGTACAGCGTCCGCTGGAGCGTCTTCCAAACCTTTA
CCTTCCCCGAGACCTCCTTTACTGCCGTCACTGCCTACCA
GAACACTAAAATTACAAAGCTGAAAATTGACCACAATCCC
TTTGCCAAAGGATTTAGAGATGAGGGAACAAACTCTAAAA
GGCGGGCAAACAGAAATCTGCCTGATCCCGAGCGAGTTGC
AAAGAAAATGTCGAAAGAGTCTGAACATGGAAGCCCACGA
GATGTCCAGCCGTCATCGTGTGAAGCTCTGGATGATGAGC
ATGCGGGCCGTAAAGAGCTGGAGGTGAAGGCTGAGCGATA
CTCCCCATGGGGCGGAGCTTGCGACCGGGACAGCGGACAC
GCTCTCCGTCCAGAGTCCCCACTGGGATCAGACCATCGAG
ACGTGTACAGCTCCGAGCAGCTCGTTCCAGGACAGAACAC
ATACCAGCCGTACAGATTTCACGAATACGGCAAATCCCCG
TCTCCATCTTCATCTTCCAGCGTTGGCGGCAGCAGTGCAT
GTGGAAGCGCGGGACGTCCCAGCTTTGAGTCCCGAGTCTT
GGACGTGGCCACCGTGCCCGACACAGACAGCTCCAGCAAG
CCCTCCTCCGCTCCAGAGTTCAGCCTCCCTCCGCATCCCT
CTGCAGGACACCAGGAGTACGCTGGAGTGCTAAACATGGC
CATCACCCAGGCCAAACCAGGCATGCTGGGAACTCATCCG
CTTTACAGCCACTACAGCACAGAACAGTCTCTGGGGCAGT
GGAGCGGGGCAGCAGCATCCCAATACCCGCCTCCACCTCC
GCCCCATCATCACCTTCCCACCGAATACAGCAGCCAAGCT
GTCCATCATGGCTATCACCATGGAAACGTTGGCGATTGGA
GCCAGTATCCGCTTTTCTCATACTCGTGCTGGTGAGCCGG
ACACCGATTGAGAGACCATTTTGAGGATGCTTATTTTTAA
TTTTCTGCACGATGAGGTCTGGATGGTTTCTCATGACCTG
TAAAATGGCACACGAAGTCGCCCGGTACTGAGTGTACCAA
AAGTGAACACAAACTGTGAGAGGACGCACTAACTACACTT
GCAAGAAGTATCCTAATTTTCTGACTGAGTTTCTAGTCTA
AATATTGATTAACTGTTAAATTAAATTGACAAGACAAAAA
TAAAAATGTTTTAGGAAATCATGAGTGAAAATTGAGAGTT
TTTATTTATAACTAGCTAAATATTTGGATAGTGGGGTTAG
TAAAATAATATAGTTACACTTATTATTTAGAGTAAAAATA
TGCATTTTAATTTAATCTTTTATCCATATTTAGATTTATG
TTTTAATGTAAAATTAATCTGCCAGTGCAGATTTAAAAAC
AAAAAAGTATTTCAATCTAATAACGTATTTTTATTATTAT
TTTTACATAAATTATTATGTTATTATAGATAAATAATTAT
TAAAATAATTTAATTTATAATAAATAAATATTATGTTATT
ATAAGTTTAAAATTCAGTTTTTCCATATTTTAAAATGAAA
CGATATTAATTCACTAACACCACTGGCAGATTATTTAAGT
AGTTTTAAATTAAAAACTCACTATTTTCACTTGCTATTTC
TGGACTTTCGTCTAAAAAAAAAGTGCATGTTTGATTAAAA
AATGTATCGATATTTAGACTTAAAAACTCTCAAAAAATAT
AAAGAAAAATTAAAAGTAAAAAATGTGCTTATTTTTTCAT
TATTATCAAATCACAAGGGGTTTTCCTTAAAACTATCAAC
AAAACAACCCCACTTAATTTCGCTTTTTATTTAGTGAAAA
AAAAAGCATTTTAATTTAAGATTTTATGGATACTTAGATT
TATGTTTTTTTATGTCAAAATCTGCCAGTGCAGTTTAAAA
GAAAAAAAAAAAAAAGATTTCAATAAAACAAAGTAATTAA
ACTTTACAATAAGTATTTAAAATTGTACATTTTGTTGTGC
GCGAGTTTTAAAAACTCACTTAATTATTACTTATTATTTG
TCTTTATTACTTAATTTTATTTGTCTAAAAATGCATATTT
GATTTTAAAATGTATCGATATTTAAACTTAAAAACTCTCT
AAAAATATAATGAAAAATGACAAGTAAAAGATTTGATTAT
TTTTTTCATTATTAATAAATCATAAATAAGTTTTTTTCTT
CTTAATCTATAAAAAACACTTAATTTTCGGTTATTGTTCC
TTGTAAAGTATGCATTTTAATTCAAGATTTTATCAATACT
TAAATTTGTTTTTATCTCAAAATCATCTGCCAGTGCAGAT
TTGAAAACAGAATTATTTCACTTTATTATGAGTATTTTAA
ATTGTTAGTTTTTTATATTACAATGTTAAAATTAATAGGT
TTTAAAATAGTTTTAAGAATGAAACCCCTAATTGTGACTT
ACTAATACTAAAAAAAAAGAAAGTGTTTTTACTTTTAATT
TTTTCTAAACAGTTTGTCTAAATATCAAAAATGTTCGAAT
CAAACATGCATTTTTTAGACAAGAAAAAGTTTTCTTTGAA
CATAAAAAGCAAAAAAGTTATTTTCAATAATTTTAAGGAA
AAACTCTTAATTGACATTAATAATAAATAAAAAAATTTTT
TTTTTGGAGTTTTTAATATAAATAAAACATTTTTTAATCA
AACATGCATCGTAAATAAGAAGCAAAAATTATGTGAGTTT
ATATTTAAAACTATCTAAATAATTGCAGAGTGGCGTTGGT
GATTTAATATTGTTTTCAGTTTCAAAAGATTGAATTTGAA
ACAATTATAATAAAGTGAAATAATTTTGTTTTCAGATTAA
AATAGACTTTTTTTTAAAAAACCTCAGTCATCTTATTTAG
CTTGTTTTATAGAAAAACATAATTTTGACTTATTATTAAT
GAAAAAAAAATTCTTAACATTTTTTTGAGAGTCTCTAGTC
GATAGTTTTTGGGAATTATAAGTAAATATTAAGTGATTTA
AAAAATTTATAACAAGCAAAATAATCTGCCAGTGTTGTGG
AAAAAATTACTTGTTTTTTTTTCTTTACATTTTTTGGAGA
GTTTTTAGTCTAAATATCGATACAATTTTAAATCAAACAT
GCATCAAAAATAATAAGTGAAAAATAAATAAGATTTTGTT
TAAAACGGCTAAACAATCTTGGCCAGTGATGCTAGTAAAT
TAATATCATCTTCAGTTAAGTATTTATAATAAAGTAAAAT
AATTCTGTTTTCATTTTGTTATGTTTTTACTCCAAAGGCA
AATTATTTTGCTTGTTTTAAAGAAAAACCCTCAATTTTGA
CTTGTTAATAAAAAAATTAATTAAATAAAACAAAAAATTA
CCTGTCATTTTTCTTCTATGTATTTCTTTTTTTGAAAGTA
TCAAGTCGATAAATTCTTAAACCAACATGAATTTTCGGAA
ATCGTTAGTGAGAGTTATGAGTATTTATTTTAAATAAGCA
AAATAATCCTGGCCAGTGGTGTTAGTAAATTAATATCATT
TTCAGTGTAAAATTTACAAAAAAAAAACTAAACATTTTTT
TTCAAATTGAAATACAAGTCTTTTCTTAAAACACTATCAG
ATTATTTTACTAGTTTTAAGGCGAAACTCACTCAATGTTT
ACTAATAATGAAAAAAAAAAAAATTTGAGTTGTCAAAAAA
ATTGCCTGTTTGTTTAAGACATTTTTAGATATTCGGACAC
AAAAAAATTAAGAAAAGCATTATTATTTAGCAATATATAA
CATTTGTGGGTCAGTTTGGATGCAAATAAAGAAAGTGCAT
CAGTTTAACCAAACTACAAGTCTGTCTGCTAATTTTACAT
TTTTTGTGTGTTTTTTCGACTGTGAAGGGAAAAAAATAGC
ATTGTGATGGACCATTTGGAAATGTTTCTCTGTAGACTTC
TATCTTAAAGCGTTAGTTCACCCCAAAAATGAAAATTTAC
CATATTGTTTATTTGCTTATGGGGTTTTATGGTTGAAAAC
GGACACAAAAAAAGATATTTGGACTAAAATGGAAGTCAAT
GCACAAAAGAGGGAAAAAAAAACCCTCAAATATGTTTTAA
ACAAATAAACAATGACAGGGTTTTCAATTTTAGGTGAACA
GCCTCTTAAAATGGACCCACAATTGACGGGCTTTCCTGGC
TTAAAAATGTCTATTTATTGTGTGTTTGCTTTTGCTGCTA
CGTAATATTATTTTTGTTAAAAAATAAGAGAAATGTAGTG
TAAAATGCTGTTTGGAAGTGGCTGAGTTATATGTCTGAAA
TTCTGAGTGGTCAGTAAACATCTTCAAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations