Transcript

nphp1-202

ID
ZDB-TSCRIPT-090929-19448
Name
nphp1-202
Previous Names
  • nphp1-002
  • zgc:152930-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039144 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039144|OTTDARG00000028659|ZDB-GENE-060929-1234 nphp1|OTTDARP00000031319 nphp1-002 LG_none BX649523.10,BX248391.22 Danio rerio protein_coding KNOWN, 962 bp
GCAACCTCATTCGGAGCGTCTGTCCTGTCATGGCGCTGCA
GATGCATCTTCTTAAAGCAAATCTGAGCGCAGCAGGGACA
TTTCTACAAATCTCACATTCGAATTGCCGTTTGTGATCGA
TCCTTCTGTCGCGAATACAACATGCCTCCAAAGAGAAGAG
GGCCCCTTCAGATTGTCCAAAGAGAAACGGATGACATCAA
GCGACAGGTGGATGCTTTGGTGCAGCAAGCCGCTAAAGCA
GATGTGTCAGAAAACAAAGAGGCCTTGCAGAGGTGCAGAG
AATTACAGCGCTTAGTGGACGACATTATGAAGAGGCTGAA
GAAGTTATCTAAAGCAGATGAACCAGCTCCAGTTGGAAAC
TATGACCAGTGTAAGAGGGAAGAGGAGAAGCGGTTATTGA
CTTTACATGATCATCTACAGTCTCTAGCTCTTCAGCTGCT
GCCTCATGATGAGACGGCTGGACCTAGTTCTTCACATACA
GAACAGGACAGCGAGGAAGAGGATAGTGATGAAGAAGATG
AGAGCTCTGAAGAGGAAGATGCTAAAGGAGACGTACACGA
GGAAGATGATGATGCTGACAGTGCTGATGAAGATACAGAT
ATGGCTGCTGCTGCAGAACAGGGATCTGCCTCCTATATCA
CTCTCAGTTCGTTTACAGCGGAGGAGGAAGGGGATCTCAG
CATTCAGAAAGGAGAGATTCTAAAAGTTTTGTCAAAAAAT
AAAGATGGATGGTGGCTAGCGCAAAACTCGAATGGACAGA
AAGGCCTGGTGCCTAAAACTTTTCTAAAGGTGTGTATAAA
GTCAGTGACACTCAGTGAGTGAGTTTAATTCTACTGTGTT
ATTACTTGATAACATGTAAGGTCATATAACCACATTCCAT
TGAGTTTTTAACTGCAGGAAATGCATAAAAATGTTTAAAG
GATTACTTCATTATCTGTTTATTAAATGATACTATTGATC
AA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations