Community Action Needed: Please respond to the NIH RFI
Transcript

nphp1-201

ID
ZDB-TSCRIPT-090929-19447
Name
nphp1-201
Previous Names
  • nphp1-001
  • zgc:152930-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039143 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039143|OTTDARG00000028659|ZDB-GENE-060929-1234 nphp1|OTTDARP00000031318 nphp1-001 LG_none BX649523.10,BX248391.22 Danio rerio protein_coding KNOWN, 2240 bp
AGCAACCTCATTCGGAGCGTCTGTCCTGTCATGGCGCTGC
AGATGCATCTTCTTAAAGCAAATCTGAGCGCAGCAGGGAC
ATTTCTACAAATCTCACATTCGAATTGCCGTTTGTGATCG
ATCCTTCTGTCGCGAATACAACATGCCTCCAAAGAGAAGA
GGGCCCCTTCAGATTGTCCAAAGAGAAACGGATGACATCA
AGCGACAGGTGGATGCTTTGGTGCAGCAAGCCGCTAAAGC
AGATGTGTCAGAAAACAAAGAGGCCTTGCAGAGGTGCAGA
GAATTACAGCGCTTAGTGGACGACATTATGAAGAGGCTGA
AGAAGTTATCTAAAGCAGATGAACCAGCTCCAGTTGGAAA
CTATGACCAGTGTAAGAGGGAAGAGGAGAAGCGGTTATTG
ACTTTACATGATCATCTACAGTCTCTAGCTCTTCAGCTGC
TGCCTCATGATGAGACGGCTGGACCTAGTTCTTCACATAC
AGAACAGGACAGCGAGGAAGAGGATAGTGATGAAGAAGAT
GAGAGCTCTGAAGAGGAAGATGCTAAAGGAGACGTACACG
AGGAAGATGATGATGCTGACAGTGCTGATGAAGATACAGA
TATGGCTGCTGCTGCAGAACAGGGATCTGCCTCCTATATC
ACTCTCAGTTCGTTTACAGCGGAGGAGGAAGGGGATCTCA
GCATTCAGAAAGGAGAGATTCTAAAAGTTTTGTCAAAAAA
TAAAGATGGATGGTGGCTAGCGCAAAACTCGAATGGACAG
AAAGGCCTGGTGCCTAAAACTTTTCTAAAGATGTCATCCT
CTCCACAGGACAGTGAGAGAGAGAATGAAGATGAAGAGGA
CAGCGAGGAAGAACAGGAATCCAGCAAAACATCCAATTGG
AACACAGTACGGAAGGCTGTAACTGAGATTGATGCTACAG
ATGTGCTGTCGGCGATGGGTGCTATTCCTCCAGGCTTCAG
ACCTTCAACATTATCCAGACTTCTGGAGGAAGGGTCATCT
TACAGAGCAAGTCACTTTATTCAACCCAAGCTTAGCCAGT
CTCAACTGTCATTTAAAGATCTCCATATGGATCCAGACAC
AGGAAAGGTTCACGGTCGGCCATCTAGAGTCAGTTTAACC
CTGACCCTGTGGAGCTGTAGAATGATCCCATCACCCGGGG
TCGGGTTACAGGTGCTTAGCAGACACGTTCGGCTCTGTGC
ATTTAACGGAACTCAGGTTTTGAGTAACATCCACACAGTC
AGAGCCACTTACAACTCCAAGAACCCAAAGACTTGGAGCT
TTTCTCCACGGATGACTGGGATGCTGCCCTGTTTACTGGA
TGGAGATTGTTTTCTGCGTTGCGACTCTGAATCTTCCGAT
CTTGGAATTCTGTTTGAATTGGGTGTAACCTACATAAGAA
ACTCTACTGGGGAGAGAGGAGACCTCAGCTGTGGCTGGAC
TTTCCTTAAACTGTTTGATGAAAGCGGAGCCCCCATTGCT
CTACGGACACAAGAGCTCACCATTCATGGTGGCACGCCAT
TCGAGAAAGACTTAGATATGGATACCATGTCTACAAAAAA
AGGGTATCAGACTGGTGTGTTTCACCAGATGTTGCTCTCC
AGGAAGATGCCAAAACTTGTTGTGAAGCTCAAATCGCTAA
ACTCAAGCAGCAGATCGCGTCTGAATCTGCTGCCTGACAC
TATCGTAGGAAGTCTGTCCACATTACATCTCTTGGCGACA
TACAGGCAAATTCTCGCTGATGCTCTTTTACTTGACAGAG
TGACCATGTGTAATGCAGATCTGATCTGCAGCTCAGTTTT
AGCCTCCTTTCCTAATGTTCTAGATCAGCCAGATCTGATG
GATGCATTTAGGAAATCCTGGAGCGAATCAGAGAGTAACC
TGAAAAGATCTGAAAAGAGGGATATAAACATACTAAAGCA
GATGTTTGTGAGTGTCTACATGGGCAGCGTGTTTCCATTG
CTGTTTTCTGCAGAAATGCCCACTCCCTGCTGGGCTGATG
AGGAAACGGAGTCTCAGCGCGCCCGTATCATCTACAACCC
TTCCCAAAAAACCTCAATAGAAACTCTGCTGTCCTCCCAA
AACTCACATCAAGCCTTTGACATCACACAGGTCACCTATG
ACCTCATCAGCAGTGCCCGCCATTGAGTCCAGAGACTTAT
CACAAGCTCCTCCAAAAGATAAGTGTCCAACTTCAAAGGA
AACTGTATTTAAATGTTAATAATAAATCTCTCACACCCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations