ZFIN ID: ZDB-TSCRIPT-090929-19378
Transcript Name: lyz-201
Previous Name: lyz-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039072 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039072|OTTDARG00000028627|ZDB-GENE-020515-2 lyz|OTTDARP00000031267 lyz-001 LG_ CT574587.12 Danio rerio protein_coding KNOWN, 603 bp
ACACCTCCACTGGTCTTGATAAAGCAGATATCAGCAGTGA
TACAATATGAGGCTGGCAGTGGTGCTTTTGTGTCTGGCGT
GGATGTCCTCGTGTGAAAGCAAGACACTGGGACGCTGTGA
TGTTTACAAGATCTTCAAGAATGAAGGGCTTGATGGATTT
GAGGGATTCTCCATTGGCAACTATGTGTGCACTGCCTACT
GGGAAAGCAGGTTTAAGACCCACCGAGTGCGTTCAGCTGA
TACGGGGAAGGACTACGGGATCTTCCAGATTAACAGCTTC
AAGTGGTGTGATGACGGGACCCCTGGTGGGAAGAATTTGT
GCAAAGTGGCCTGTTCAGACTTGCTTAACGATGACCTGAA
AGCTTCAGTTGAGTGTGCAAAGCTGATTGTGAAAATGGAC
GGGCTGAAATCATGGGAAACCTGGGATTCTTACTGTAACG
GTCGTAAGATGTCCCGCTGGGTAAAAGGCTGTGAGCAGCG
CAAACAAAGCCTCCGAGCCTGATTACCTACAGTCATTATG
TGCTAATGCATGTAAAACATTTTAAACAGGCATCGTCATC
ATTAATGTTTGAGATGAATATTAAAGCATCTTCCTAAATT
GTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lyz-201 Contained in:
[BAC] CH211-80N22 (1)

Genome Resources: Vega_Trans:OTTDART00000039072 (1),  Ensembl_Trans:ENSDART00000080549 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC092921 (1) 633 nt
GenBank:BC114260 (1) 622 nt
GenBank:AF402599 (1) 596 nt
CITATIONS (2)