ZFIN ID: ZDB-TSCRIPT-090929-19378
Transcript Name: lyz-201
Previous Name: lyz-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039072 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039072|OTTDARG00000028627|ZDB-GENE-020515-2 lyz|OTTDARP00000031267 lyz-001 LG_ CT574587.12 Danio rerio protein_coding KNOWN, 603 bp
ACACCTCCACTGGTCTTGATAAAGCAGATATCAGCAGTGA
TACAATATGAGGCTGGCAGTGGTGCTTTTGTGTCTGGCGT
GGATGTCCTCGTGTGAAAGCAAGACACTGGGACGCTGTGA
TGTTTACAAGATCTTCAAGAATGAAGGGCTTGATGGATTT
GAGGGATTCTCCATTGGCAACTATGTGTGCACTGCCTACT
GGGAAAGCAGGTTTAAGACCCACCGAGTGCGTTCAGCTGA
TACGGGGAAGGACTACGGGATCTTCCAGATTAACAGCTTC
AAGTGGTGTGATGACGGGACCCCTGGTGGGAAGAATTTGT
GCAAAGTGGCCTGTTCAGACTTGCTTAACGATGACCTGAA
AGCTTCAGTTGAGTGTGCAAAGCTGATTGTGAAAATGGAC
GGGCTGAAATCATGGGAAACCTGGGATTCTTACTGTAACG
GTCGTAAGATGTCCCGCTGGGTAAAAGGCTGTGAGCAGCG
CAAACAAAGCCTCCGAGCCTGATTACCTACAGTCATTATG
TGCTAATGCATGTAAAACATTTTAAACAGGCATCGTCATC
ATTAATGTTTGAGATGAATATTAAAGCATCTTCCTAAATT
GTA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lyz-201 Contained in:
OTHER lyz-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000039072 (1)
  • Ensembl_Trans:ENSDART00000080549 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC092921 (1) 633bp
    GenBank:BC114260 (1) 622bp
    GenBank:AF402599 (1) 596bp
    CITATIONS (2)