Transcript

id2a-202

ID
ZDB-TSCRIPT-090929-19353
Name
id2a-202
Previous Names
  • id2a-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039047 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039047|OTTDARG00000028615|ZDB-GENE-020910-1 id2a|OTTDARP00000031245 id2a-002 LG_ CT737254.12 Danio rerio protein_coding KNOWN, 908 bp
ACAGCGATGACAGCTCGCTAATCCACTGCGTTTGCTTCAA
CAGCCCAGCGCGAACAGGGAATCTCGAACACAAAAAGGCG
AGTCTTTTCAACGAAATCCTGCTGTCAACATGAAGGCAAT
AAGCCCAGTGAGGTCCTTCCGGAAAAGTAGCGCGAGTGTA
ACGACGACGGAGCACAGTCTGGGAATCTCGCGGAGCAAGA
CCCCCGTGGACGATCCTCTCAGCCTGCTCTACAACATGAA
CGACTGCTACTCCAAACTGAAGGAACTGGTGCCGAGCATC
CCGCAGAACAAAAACGTGAGCAAAATGGAAATCCTCCAGC
ATGTCATCGACTATATTCTGGACCTGCAGATCGCGCTCGA
CTCCAATTCGGCGATAACCAGCCTGCATCACCCGCGAGCG
GGGCAGGGGACATCCAGAACACCCCTGACAACACTCAACA
CAGACATCAGCATCCTCTCACTACAGACACCTGAGTTTCC
ATCAGACTTGATCACAGAGGACAGCAGGACACTTTACCGT
TAATCAGGTAAGTTTTCTTGAAAATACAATGTTTTTATGT
GTTTTTAATTTTTCTATTAAATGACAAGTATTTGATGCAG
AGGGTTTAGTTGAGGAGCAGTGTGCATGTGTGAAGTTGCA
GAAAGTGTGTTGACTTTGCAAAAGCGAAGGCAGAAGTTGT
GTACTGGTGTACATCTGGAGCCCAGGGTTTTTTCGCTCAG
TCTCTGAGTGTTTGGTTAAATGTTCAAACTGCGGCTTCCT
CTCTGGCGCCAGGCTGTCCGGATCTCTGCCCTGTTTGCAT
TCTCTAAATGCGCCTCTTTCTCAATCTTTTGCAGGTGTTT
GGTTAAGACACAAGAACACACAGGACCTGGGAACTGGCTT
TTCCTCTGATTTCTGTTCTCAGTCTGGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations