ZFIN ID: ZDB-TSCRIPT-090929-18958
Transcript Name: adrb2b-201
Previous Names: adrb2b-001, zgc:162188-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038590 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038590|OTTDARG00000028373|ZDB-GENE-070410-32 adrb2b|OTTDARP00000030922 DKEY-212J2.1-001 LG_ CR762496.7 Danio rerio protein_coding KNOWN, 3764 bp
TCAGCTGGCAGCGCTGTGAGCATGTCAAAGAAACAGACAA
ATGACAAGGTGCAACAGAAAGATCAATGAGCACACTTTGT
GAGAGCAGAATACTTTAGAGAACAACATCTCAAAGGGATT
CGTTTTGGATATCTCACGGGAGTCCATGAAAAGTGGATTT
AAGTTGGACAACTCACACCCTCTTCTGATTTAGTCAAAGC
TCATGGAGGGAGACAATACGCTGATCACGGAGAACACCTC
CCTGTATATGAACATTTCAGCTGGGCTAAACGCTTCCTCA
CCAGTGTCTCTCTCTGTCTCAGAGTACAGCGATGCAGAGG
TGGTCTTAATCAGCATCTTAATAGGCATTCTGGTTCTAGT
CATTGTCTTTGGTAATGCGCTGGTCATCAGTGCCATTGTA
CGATTCCAGCGCTTGCAGACTGTCACAAACTACTTCATCA
GCTCCCTGGCGTGTGCTGATCTAGTCATGGGTCTTATGGT
GGTGCCCTTCGGCGCATGCTACATTCTCCTCAATACATGG
CACTTTGGAAACTTCTTTTGCGAGTTTTGGACGGCTACGG
ATGTATTGTGTGTGACCGCTAGCATTGAGACATTGTGTGT
GATTGCTCTGGACCGGTACATAGCCATCATGTGGCCTCTG
CGTTATCAGTCTATGCTTACAAAGCGGAAGGCCTGCGGGA
TGGTCATAGGGGTGTGGGCAGTGGCCGCCCTTATCTCGTT
CCTACCCATCCACATGGAGTGGTGGGTGTCAGATGAACCT
GAGGCGCTGAGCTGCTTGGAAGAACCCACCTGCTGCGACT
TCAACACCAACGCTGCGTACGCCGTGACCTCCTCCATTAT
CTCCTTCTACATCCCGCTGGTCATCATGGCGTTCGTGTAC
AGCCGGGTCTTCCAAGAGGCCCGTAGGCAGCTTCAGAAAA
TAGACCGCATTGAGGGGCGAATACGAACACAGAGCTTAAG
CACCCAGGAGGGAAATGAGATAAAGAACAGGAGGACCAAG
TTCTGCATGAAGGACCACAAAGCTCTGAAGACCTTGGGGA
TCATCATGGGAACCTTCACCCTGTGTTGGCTGCCATTTTT
TGTGCTTAATGTGGTGGCAGCCATCTGGAAGATGGACAAC
ATCATGTTGCCCTTCAGGATCTTAAATTGGATTGGCTACG
CCAACTCTGCCTTCAACCCATTAATCTACTGCAGGAGTCC
TGAGTTTAGATGTGCTTTTCAGGAAATCCTGTGCTGGAGA
CCCTCTCATCTACCTTCCACAAGGAGTAAAAAGGGATATC
TCTACAGTGGTCACAGCTGGAAGGTTCACACAAAGACCAC
CAGACCACGAGAGCCCTCGCCGGCTTGTGAAACAGAAATT
GGTGCTGAATGTTTGACTGCAGGCACCAAAAACAAAAATG
GGAATTATAATAAAACTGTGACGTCCATTTAGGGCACTAA
ATATATCCGGTTGAAACTGTTTTTGTCTGTGACAAAACAT
CCATTTTAGATATTTAAGCCTTTGAACCAAGATGGTTTGC
CTATATTTAGACAATATTTAATTATGAAACTTCAGAACAA
ACGGAAATGAAGTACTGCTTTGGGACAAATTGTGTGCATG
AAATCCAGGACAGATTTGGAAAGGCAAGACAGTCAGAAAG
TCTACCTCTGGATTACATTTACTACCTCGAGACACTTTTT
ATGTCTCAAAAAACCTGCATTGATATTTCATTTGTAATTT
ATGAATAAATGTCCCAACTTACAACCGGAATATGTGGATT
ATAGATCAGAAGGAGCAGTGTCTTATAGCAGACAGACATG
TTACATTCCATTAAGAGAAAACCAGGGTCTTCAGTATCTC
CGAGACCTCCTCCGGAGAGATGAAATATAACCCTTTGATT
AGGGACAACAGGTGCACATTGCCGCCTGTGCTATAACCAG
CTGTTCTTGTCAAACGTGAAGGAGCCAAGCAGTTCTCCAA
GCCCTGCACTTCAACCTTCCCCTGTTAACATTTCCACTGG
GAAACCATTTTAAGGTTACAGTTGAAGCCGTATCTATAAA
GGGTCGTGTTTATGAAAGTAAGTACACAAGTCTACATTTG
CGAGCTGGGTGGCACAGAATGATGGCGTATTTAACACGTC
ACTACATGTAATGATGGTGCCAAGTTATTCTCATTACTAA
ACAGTATTTAAAAGTTGACTCTCAATGCTATGTAAGCATA
TTAATTTCAGGAACACAGCTTATGGAACCTAATTTATGTT
GGTTATGCTTCCATAACTGTAATGTTTGTACTGTTTACAG
ATTCCTGAGCTAACAGTCCATAGGACAGACACCCCAAAAT
CCCGATTACAAGCTGATGGTTGTTTCCATCTGTTTATAAT
AATAGCTCAGGCAATGTACTTGATAACTGGATGCATTACT
GGAAAATGTCTGACATTACAAAAAGCTGACAAATGTATCT
TACGCAATGGTGTGGTTGATGTCACTGACAGTGGGGTTGC
TCATATGCATAGCATGCGTTGTGATCTTTGAGCCTCCTTC
CTGAGTATGTGTGCACAAATCAGTTTAGACATAAAAACCA
AATGCATAAAGCTTATGTGGCTGCATAGACCTCAGTCAGG
GTAATGCTGTTTTTATTTTAATCTATTAATTACATGTATG
AAAAAGGCTGTGAGGCATAGAAGTACAGTGTCCTCAAAAC
CCTTTAGTGTTCATTATTAGCATTCTCATTTTCAGCTTTT
AAAAACAATGCCAATAGAAGACAAACATTTTTACAGTGCA
TGATTTGGTCCTCACAGCTTTTGTTTTACTCACATACAAT
TTAATATGGTGTCTATATTCCAGAAGAAATGAGGTACAGT
AGCTAGAGAAGAACTGTGTACAGTATGTAAGGATTAAAAC
TTACAGATATTGAAAATACTTAATACTTGAATGAATAAGA
AATATATACAGTATTTATTACACATTTTTTATAATAATTT
TTTTAGATTTTTTAATAATTTAGTCAAACTTAAATGTACA
ATAATATAAATGAAGAGTTTGGATGCAAAAACCTCTTAAT
GCTGTCTAAAATTTTCTCTTAAAATTAGCATTTTTCTCAG
TCTCATATGTTCTTTACTTAATAGACAATGAAAATAACTT
ATTTGTTACTATATAGATACAATTCCTAAGGCTACACACA
AGAGTCGGAGAAAAATGCTAATTAAAAAAAAAAACATGCG
GCATTTAGAGGTTTTTGCATCTAAACTCTTCATATACAAT
TTGTACAATCAATATTAGTGTATTTATTTACGTTTTAAGC
TAACTTTTCCTAAGTATTAAGTATTTCAAATATCTATAGA
ATTGTTTTTTATAAAATATATTCTTTGGGATAGAAAAAAA
TGAGAAGCTTGAATCGATTTCTTTACGTGAGGCATTTAGG
CTGCTTAAATTTGTTGTGGGTACTGTATTAATGGCGTCAT
TAATACCTTGATAAATACGTTCGTGTGTTCGGCTTCTTGT
GAAAAGTATTAGTAACTTCTCCTCAAAGTCAAACGTCGTC
TTAGGCACGTTTTGTATGAATCTATGGACAAAGCACTAGC
CTAATGTGTTACTGTGTTTGACAGCACATTTCTGATGGTA
TTTGCTTAGTTTGTGTCATTCCACGAAGCGCCAAGTGCAA
CTGTTTCCTATACTTTTACTACAAAAATGTTTTGAGCCGT
ATTATTTTTGTTTATTATTTATTTTTGTATGTCCAACCAG
CTGCTCAATGTACAAAGTGACAAAATAAACATGGTGTTTT
GTAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
adrb2b-201 Contained in:
OTHER adrb2b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038590 (1)
  • Ensembl_Trans:ENSDART00000146454 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC139539 (1) 3728bp
    CITATIONS (2)