Transcript

slc7a3a-002

ID
ZDB-TSCRIPT-090929-18813
Name
slc7a3a-002
Previous Names
  • slc7a3-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038430 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038430|OTTDARG00000028266|ZDB-GENE-041114-206 slc7a3a|no_translation slc7a3-002 LG_none CR749164.18,CT025910.8 Danio rerio protein_coding KNOWN, 536 bp
GTTGTGAAGTGGATAATGAGATTTTCCTCCACAAGATTTA
ACACATCCGTTTGTCCTCACAGACGGATAGAAAGCACATT
TGGAAGTGGAGGCTTTGCTCCGTTCGGCCTTGGCGGCATC
TTATCAGGCGCAGCCACCTGTTTCTACGCCTTCGTGGGCT
TTGATTGCATTGCTACGACAAGTGAGGAAGCCAAAAACCC
AATGCGCTCCATCCCTGTGGGCATCGTGGCCTCGTTGCTC
ATTTGCTTCTTTGCTTACTTTGGTGTCTCAGCTGCTCTTA
CGCTCATGATGCCCTATTACAAGCTCAACACTCAGAGTCC
TCTGCCTGAGGCCTTCAGTTACGTAGGCTGGGCACCAGCA
CGATATATTGTAGCCGTGGGTTCACTCTGTGCTCTTTCCA
CAAGTTTGCTGGGCTCCATGTTCCCTATGCCTCGAGTGAT
TTACGCCATGGCTGAGGACGGGCTACTCTTTCGTTCACTT
TCCAGGATGAACAAGAGAACCAAAACTCCTCTGCTGGCGA
CTATTGCGTCTGGAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations